Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
pEN_hU6miR-Gb2-K
RRID:Addgene_25759 RRID Copied  
PDF Report How to cite
RRID:Addgene_25759
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/25759

Proper Citation: RRID:Addgene_25759

Insert Name: Gb2 miR-shRNA

Organism: Mus musculus

Bacterial Resistance: Gentamicin

Defining Citation: PMID:16945906

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin

Comments: Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pEN_hU6miR-Gb2-K.

No alerts have been found for pEN_hU6miR-Gb2-K.

Data and Source Information

Source: Addgene