Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/230038
Proper Citation: RRID:Addgene_230038
Insert Name: MG1655 attP21::PR-mCherry::frt trpC::frt
Bacterial Resistance: None
Defining Citation: PMID:32042125
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for TB205 △trpC.
No alerts have been found for TB205 △trpC.
Source: Addgene