Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/220921
Proper Citation: RRID:Addgene_220921
Insert Name: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Organism: Other
Bacterial Resistance: None
Defining Citation: PMID:38499480
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Comments: Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for eScaf.
No alerts have been found for eScaf.
Source: Addgene
