Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSAM_Ec Resource Report Resource Website |
RRID:Addgene_102939 | mariner transposon flanked by MmeI modified inverted repeats and the himar1C9 transposase | Other | Ampicillin and Kanamycin | PMID:23990803 | The Plac promoter from pGFP-Mut3.1 (Clonetech), along with its associated ribosome binding sequence, was amplified via PCR. Engineered 59 BamHI and 39 NdeI restriction sites were used to sub-clone the resulting fragment into a BamHI/NdeI (New England Biolabs) double digested pSAM_Bt vector upstream of the himar1C9 transposase gene. The kanamycin resistance gene from pKD4 was amplified and ligated using the restriction sites MfeI and XbaI, replacing the erythromycin resistance gene ermG in pSAM_Bt. The resulting transposon mutagenesis vector, pSAM-Ec, was stored and propagated in the pir+ E. coli strain EcS17. | Vector Backbone:pSAM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:22 | 0 | |
|
LSB-hsa-miR-125b-5p Resource Report Resource Website |
RRID:Addgene_103191 | hsa-miR-125b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-let-7f-5p Resource Report Resource Website |
RRID:Addgene_103156 | hsa-let-7f-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-101-3p Resource Report Resource Website |
RRID:Addgene_103165 | hsa-miR-101-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-105-3p Resource Report Resource Website |
RRID:Addgene_103169 | hsa-miR-105-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-let-7a-5p Resource Report Resource Website |
RRID:Addgene_103146 | hsa-let-7a-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
6377 H10-104b Resource Report Resource Website |
RRID:Addgene_1248 | Hsp104 | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:9674429 | Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:22:03 | 0 | ||
|
pHybr_r2a>Fab-srt-his Resource Report Resource Website |
RRID:Addgene_124810 | rat IgG2a Hinge-G4S-Sortag-Histag | Rattus norvegicus | Ampicillin and Kanamycin | PMID:31489367 | Backbone Marker:Thermo Fisher; Backbone Size:3956; Vector Backbone:pCR4 TOPO TA; Vector Types:Bacterial Expression, CRISPR, Other, HDR template; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:22:03 | 0 | ||
|
PCRII apoA-IVa Resource Report Resource Website |
RRID:Addgene_121902 | ApoA4a | Danio rerio | Ampicillin and Kanamycin | PMID:25633982 | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:21:00 | 0 | ||
|
PCRII apoBa Resource Report Resource Website |
RRID:Addgene_121897 | ApoBa | Danio rerio | Ampicillin and Kanamycin | PMID:25633982 | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:21:00 | 0 | ||
|
PCRII apoBb.1 Resource Report Resource Website |
RRID:Addgene_121898 | ApoBb.1 | Danio rerio | Ampicillin and Kanamycin | PMID:25633982 | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:21:00 | 0 | ||
|
pMK364 (CMV-OsTIR1-loxP-PURO-loxP) Resource Report Resource Website |
RRID:Addgene_121184 | CMV-OsTIR1-loxP-PURO-loxP | Synthetic | Ampicillin and Kanamycin | PMID:31026591 | This plasmid is a variant of Addgene plasmid 72834. | Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | OsTIR1 codon optimized for human cells | 2022-04-22 03:20:50 | 0 |
|
pXf20pemIK Resource Report Resource Website |
RRID:Addgene_126577 | Ampicillin and Kanamycin | PMID:27088393 | Backbone Marker:Invitrogen; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:22:27 | 0 | ||||
|
pCR2.1-Ins2-842 Resource Report Resource Website |
RRID:Addgene_53969 | mouse Ins2 gene partial | Mus musculus | Ampicillin and Kanamycin | PMID:23144715 | Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2022-09-21 01:03:44 | 0 | ||
|
pONSY Resource Report Resource Website |
RRID:Addgene_111873 | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:17:57 | 0 | ||||
|
pONSY-Lifeact:mCherry Resource Report Resource Website |
RRID:Addgene_111876 | Lifeact fused to mCherry | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:17:57 | 0 | |||
|
pONSY-mCherry Resource Report Resource Website |
RRID:Addgene_111874 | mCherry | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:17:57 | 0 | |||
|
pONSY-CoNMM:mCherry Resource Report Resource Website |
RRID:Addgene_111878 | Capsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry | Other | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:17:57 | 0 | ||
|
pMO746 Resource Report Resource Website |
RRID:Addgene_117480 | uracil phosphoribosyltransferase | Other | Ampicillin and Kanamycin | PMID:23393089 | Selection for kanamycin resistance after introduction of pMO746 identifies those cells in which integration into the chromosome of part or all of the plasmid has occurred. Kanamycin resistance is a strong selection in the sulfate-reducing bacteria (SRB). Ampicillin is not universally effective in the SRB but is often used for selection in Escherichia coli. Thus this plasmid can be readily grown in E. coli but is actually unstable in the SRB. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCR4/TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:19:35 | 0 | |
|
pCAT.000 Resource Report Resource Website |
RRID:Addgene_119559 | Ampicillin and Kanamycin | PMID:30819783 | Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint. | Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:20:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.