Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 5 showing 81 ~ 100 out of 198 results
Snippet view Table view Download 198 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_31851

http://www.addgene.org/31851

Species:
Genetic Insert: GFP (including ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: Plasmid can also be grown in mycobacteria.

Proper citation: RRID:Addgene_31851 Copy   


  • RRID:Addgene_31820

http://www.addgene.org/31820

Species:
Genetic Insert: GFP (lacking ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: Plasmid can also be grown in mycobacteria.

Proper citation: RRID:Addgene_31820 Copy   


  • RRID:Addgene_32379

http://www.addgene.org/32379

Species:
Genetic Insert: int Ms6; gfpm2+; xylEm; ttsbiA, ttsbiB
Vector Backbone Description: Vector Backbone:pMl603; Vector Types:Other, bacterial integration vector; Bacterial Resistance:Hygromycin
References:
Comments: This is an improved Ms6 integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE expression as reporter genes; terminators to protect expression cassette against transcriptional interference. Please note that the conserved N->S point mutation found in the Addgene QC sequence of the Ms6 integrase gene is of no consequence and the plasmid is still fully functional for integration.

Proper citation: RRID:Addgene_32379 Copy   


  • RRID:Addgene_32378

    This resource has 1+ mentions.

http://www.addgene.org/32378

Species:
Genetic Insert: int Giles; gfpm2+; xylEm; ttsbiA, ttsbiB
Vector Backbone Description: Vector Backbone:pML603; Vector Types:Other, bacterial integration vector; Bacterial Resistance:Hygromycin
References:
Comments: This is an improved Giles integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE as reporter genes; terminators to protect expression cassette against transcriptional interference.

Proper citation: RRID:Addgene_32378 Copy   


  • RRID:Addgene_119885

http://www.addgene.org/119885

Species:
Genetic Insert: BbaJ23104_EYFP
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_119885 Copy   


  • RRID:Addgene_17975

http://www.addgene.org/17975

Species:
Genetic Insert: pmyc1tetO-gfp, tetR(B)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pMS2; Vector Types:Other, mycobacteria expression; Bacterial Resistance:Hygromycin
References:
Comments: Expresses GFP under control of tetR(B). Also see Pubmed IDs 18059281 and 15687379. pUV15 derivative, Genotype: Hygr, Kmr, pimyc-tetR, pmyc1 tetO-gfp+

Proper citation: RRID:Addgene_17975 Copy   


  • RRID:Addgene_27057

http://www.addgene.org/27057

Species: synthetic gene
Genetic Insert: P#38-gfp-DAS+4
Vector Backbone Description: Backbone Size:6087; Vector Backbone:pTE-0X1-GCT6; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: pTE-mcs derivative (Addgene plasmid# 20320) with GFP-DAS+4 under the control of a strong promoter. DAS+4 sequence is AANDENYSENYADAS at end of GFP.

Proper citation: RRID:Addgene_27057 Copy   


  • RRID:Addgene_117695

http://www.addgene.org/117695

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:pYUB1062 was donated by William R. Jacobs from the Department of Microbiology and Immunology at the Albert Einstein; Backbone Size:5800; Vector Backbone:pYUB1062; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: This is a shuttle vector, designed for expression of the inserted gene in Mycobacterium smegmatis as well as allowing cloning and expressions using E. coli. This plasmid was constructed by Anajana Radhakrishnan from the pYUB1062 vector. pYUB1062 was donated by William R. Jacobs from the Department of Microbiology and Immunology at the Albert Einstein College of Medicine, New York, USA. References: this paper has been accepted in RSC Advances: A GFP-strategy for efficient recombinant protein overexpression and purification in Mycobacterium smegmatis: Anjana Radhakrishnan, Christopher M Furze, Mohd Syed Ahangar, Elizabeth Fullam

Proper citation: RRID:Addgene_117695 Copy   


http://www.addgene.org/119049

Species: Synthetic
Genetic Insert: Fab_Quin-LUCID_part1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_119049 Copy   


  • RRID:Addgene_119047

http://www.addgene.org/119047

Species: Synthetic
Genetic Insert: Fab_MTX-LUCID_part1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_119047 Copy   


  • RRID:Addgene_157876

http://www.addgene.org/157876

Species:
Genetic Insert: tdTomato
Vector Backbone Description: Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_157876 Copy   


  • RRID:Addgene_204626

http://www.addgene.org/204626

Species: Homo sapiens
Genetic Insert: HAPPID1 heavy chain
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6441; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_204626 Copy   


  • RRID:Addgene_118076

http://www.addgene.org/118076

Species: Other
Genetic Insert: pTEF1-cexA-tCYC1
Vector Backbone Description: Backbone Marker:Matthias Steiger; Vector Backbone:MST606; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_118076 Copy   


  • RRID:Addgene_219768

http://www.addgene.org/219768

Species: Other
Genetic Insert: Pv4CL1
Vector Backbone Description: Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_219768 Copy   


  • RRID:Addgene_222353

http://www.addgene.org/222353

Species: Other
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.

Proper citation: RRID:Addgene_222353 Copy   


  • RRID:Addgene_222357

http://www.addgene.org/222357

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments: Tn7 expression vector.

Proper citation: RRID:Addgene_222357 Copy   


  • RRID:Addgene_227580

http://www.addgene.org/227580

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:Other; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_227580 Copy   


  • RRID:Addgene_209018

http://www.addgene.org/209018

Species: Other
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
References:
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).

Proper citation: RRID:Addgene_209018 Copy   


  • RRID:Addgene_232335

http://www.addgene.org/232335

Species: Other
Genetic Insert: PbGH3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_232335 Copy   


  • RRID:Addgene_231247

http://www.addgene.org/231247

Species: Other
Genetic Insert: PPE18-ALFA
Vector Backbone Description: Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_231247 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X