Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: Fgf2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_12309 Copy
Species: Synthetic
Genetic Insert: MutL E32K
Vector Backbone Description: Backbone Marker:The Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information.
To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html
Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_120418 Copy
Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments:
Proper citation: RRID:Addgene_120812 Copy
Species: Synthetic
Genetic Insert: rsCaMPARI
Vector Backbone Description: Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_120805 Copy
Species: Synthetic
Genetic Insert: Cas12i1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at inquiries@arbor.bio. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
Proper citation: RRID:Addgene_120882 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin C
Vector Backbone Description: Backbone Marker:Ted Dawson, Addgene plasmid #17608; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_121154 Copy
Species:
Genetic Insert: Green Glifon50
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_126206 Copy
Species:
Genetic Insert: Green Glifon4000
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_126208 Copy
Species: Homo sapiens
Genetic Insert: E3-Ring domain, Ub-ligase
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4500; Vector Backbone:pET151D topo; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_12645 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin - wild type
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5000; Vector Backbone:pET15; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid contains a 76 amino acid synthetic ubiquitin insert used to determine the 3D structure of the UbcH5c/Ub noncovalent complex, as described in the associated publication.
Proper citation: RRID:Addgene_12647 Copy
Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_12679 Copy
Species: Other
Genetic Insert: AtU6-SmR-sgRNA
Vector Backbone Description: Backbone Size:3152; Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_119775 Copy
Species: Other
Genetic Insert: APOBEC3A-nCas9-NLS-UGI-NLS
Vector Backbone Description: Backbone Size:4919; Vector Backbone:pJIT163; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_119768 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pCMV-3xFLAG-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_11978 Copy
Species: Mus musculus
Genetic Insert: BICD cargo adaptor 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_120168 Copy
Species: Rattus norvegicus
Genetic Insert: calcium channel beta2a auxillary subunit
Vector Backbone Description: Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: We received it in pBluescript and subcloned it into pMT2 plasmid.
Proper citation: RRID:Addgene_107424 Copy
Species: Rattus norvegicus
Genetic Insert: vGAT-pHluorin C-term
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS E/S; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_78578 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal4 DBD(1-147)
Vector Backbone Description: Backbone Size:2924; Vector Backbone:pECE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_71728 Copy
Species: Homo sapiens
Genetic Insert: FKBP1A
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information.
Proper citation: RRID:Addgene_38001 Copy
Species: Homo sapiens
Genetic Insert: FKBP1A
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information.
Proper citation: RRID:Addgene_38000 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.