Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
P0050::kaiBC Resource Report Resource Website |
RRID:Addgene_101828 | kanamycin casette and p0050 promoter | Other | Kanamycin | PMID:28430105 | Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Other, Cloning vector; Bacterial Resistance:Kanamycin | 2022-04-22 03:15:10 | 0 | ||
|
pMZ0002 Resource Report Resource Website |
RRID:Addgene_102239 | N-ethylmaleimide sensitive factor | Other | Ampicillin | PMID:25581794 | Vector Backbone:pPROEX1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | ||
|
pET_BGL3 Resource Report Resource Website |
RRID:Addgene_101912 | β-glucosidase | Other | Ampicillin | PMID:29516725 | Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | ||
|
pET_BGL1 Resource Report Resource Website |
RRID:Addgene_101910 | β-glucosidase | Other | Ampicillin | PMID:29516725 | Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | ||
|
pET_BGL2 Resource Report Resource Website |
RRID:Addgene_101911 | β-glucosidase | Other | Ampicillin | PMID:29516725 | Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | ||
|
Bassik lab Human CRISPR-Cas9 Deletion Library - Gene Expression Resource Report Resource Website |
RRID:Addgene_101928 | Ampicillin | PMID:28474669 | Backbone Marker:Bassik lab (Addgene Plasmid #89359); Vector Backbone:pMCB320; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | ||||
|
5JJW (USP15_SART3) Resource Report Resource Website |
RRID:Addgene_101880 | USP15_SART3 | Homo sapiens | Kanamycin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SART3|USP15:YTC044-A09:C237276. SGC or PDG link: http://www.thesgc.org/structures/5JJW/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:15:11 | 0 | |
|
5KCH (SETDB1) Resource Report Resource Website |
RRID:Addgene_101881 | SETDB1 | Homo sapiens | Kanamycin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETDB1:APC043-C07:C27642. SGC or PDG links: 5KCH http://www.thesgc.org/structures/5KCH/ 6AU2 http://www.thesgc.org/structures/6AU2/ 6AU3 http://www.thesgc.org/structures/6AU3/ 6BPI http://www.thesgc.org/structures/6BPI/ 5KCO http://www.thesgc.org/structures/5KCO/ 5KE2 http://www.thesgc.org/structures/5KE2/ 5KE3 http://www.thesgc.org/structures/5KE3/ 5KH6 http://www.thesgc.org/structures/5KH6/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:15:11 | 0 | |
|
5T5G (SETD8) Resource Report Resource Website |
RRID:Addgene_101886 | SETD8 | Homo sapiens | Kanamycin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETD8:PBC001-G01:C233009. SGC or PDG link: http://www.thesgc.org/structures/5T5G/ http://www.thesgc.org/structures/5TH7/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:15:11 | 0 | |
|
5TCK (PP-BRD3) Resource Report Resource Website |
RRID:Addgene_101887 | PP-BRD3 | Other | Ampicillin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-F01:C235018. SGC or PDG link: http://www.thesgc.org/structures/5TCK/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:11 | 0 | |
|
5TCM (PP-BRD3) Resource Report Resource Website |
RRID:Addgene_101888 | PP-BRD3 | Other | Ampicillin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-C02:C235023. SGC or PDG links: http://www.thesgc.org/structures/5TCM/ http://www.thesgc.org/structures/6BYA/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | |
|
5TF2 (PREB) Resource Report Resource Website |
RRID:Addgene_101889 | PREB | Homo sapiens | Ampicillin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: PREB:YTC012-F10:C229890. SGC or PDG link: http://www.thesgc.org/structures/5TF2/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Other, Baculovirus expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:12 | 0 | |
|
5KO4 (PP-BRD19) Resource Report Resource Website |
RRID:Addgene_101882 | PP-BRD19 | Other | Ampicillin | PMID: | N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: Tb427.10.8150:MAC054-H04:C234720. SGC or PDG link: http://www.thesgc.org/structures/5KO4/ | Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:11 | 0 | |
|
pTRE2-Bla(HA–RILP) Resource Report Resource Website |
RRID:Addgene_102425 | Rab interacting lysosomal protein | Homo sapiens | Ampicillin | PMID:27791088 | Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:15 | 0 | ||
|
pPB-CAG-rtTA-IRES-Hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_102423 | tetracyclin-transactivator (rtTA) | Ampicillin | PMID:28504700 | IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG | Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:15 | 2 | ||
|
p2lox-cAMPr R626A Resource Report Resource Website |
RRID:Addgene_102437 | cAMPr | Ampicillin | PMID:29511120 | Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | PKA-R R626A | 2022-04-22 03:15:15 | 0 | ||
|
p2lox-cAMPr Y205A Resource Report Resource Website |
RRID:Addgene_102438 | cAMPr | Ampicillin | PMID:29511120 | Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | PKA-C Y205A | 2022-04-22 03:15:15 | 0 | ||
|
pcDNA3.1-hSNCA-NE Resource Report Resource Website |
RRID:Addgene_102361 | synuclein alpha | Homo sapiens | Ampicillin | PMID:30983487 | This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) | Backbone Marker:Invitrogen; Backbone Size:5900; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:14 | 0 | |
|
UBI10:RFP-RabG3B-WT Resource Report Resource Website |
RRID:Addgene_102369 | RabG3B | Arabidopsis thaliana | Spectinomycin | PMID: | Vector Backbone:pUBN-RFP; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2022-04-22 03:15:14 | 0 | ||
|
mAzami-Green-Galectin Resource Report Resource Website |
RRID:Addgene_102419 | LGALS3 | Homo sapiens | Ampicillin | PMID:26907999 | The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA6-myc his version B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.