Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: bc109
Vector Backbone Description: Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202241 Copy
Species: Synthetic
Genetic Insert: bc110
Vector Backbone Description: Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202242 Copy
Species: Synthetic
Genetic Insert: bc156
Vector Backbone Description: Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202256 Copy
Species: Synthetic
Genetic Insert: bc155
Vector Backbone Description: Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202255 Copy
Species: Synthetic
Genetic Insert: bc161
Vector Backbone Description: Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202261 Copy
Species: Synthetic
Genetic Insert: bc162
Vector Backbone Description: Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint.
Proper citation: RRID:Addgene_202262 Copy
Species: Other
Genetic Insert: EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_218768 Copy
Species: Other
Genetic Insert: pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_218769 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other
References:
Comments: Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint.
Proper citation: RRID:Addgene_229958 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other
References:
Comments: Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint.
Proper citation: RRID:Addgene_229959 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5922; Vector Backbone:pBMTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_22816 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4677; Vector Backbone:pBTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity.
Proper citation: RRID:Addgene_22810 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4617; Vector Backbone:pBT-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments: Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity.
Proper citation: RRID:Addgene_22829 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5799; Vector Backbone:pBTB-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_22822 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Other
References:
Comments: For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites
Depositor recomments the following primers to sequence the relevant regions:
gaaattccttgtcgggtaagttcc
gaacatcaaacattaaagggtggtatttc
Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification.
Protocol for the digestion reaction:
For 50 uL reaction:
1 ug DNA
5 uL CutSmart
1 uL HpyCH4III
Up to 50 uL MQ water
Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template
Proper citation: RRID:Addgene_156372 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_42520 Copy
Species:
Genetic Insert: EF1a-DTA
Vector Backbone Description: Vector Backbone:pF2; Vector Types:Mouse Targeting; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_42521 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other
References:
Comments:
Proper citation: RRID:Addgene_42519 Copy
Species: Homo sapiens
Genetic Insert: Mini-intronic-plasmid intron
Vector Backbone Description: Backbone Marker:Joseph Wu's Lab at Stanford University; Backbone Size:8062; Vector Backbone:codon-optimized minicircle (CoMiC) construct; Vector Types:Mammalian Expression; Bacterial Resistance:Other
References:
Comments: In addition to the publication listed above, more details can be found in Lu, et al. Mol Ther. 2013, PMID 23459514.
Proper citation: RRID:Addgene_63726 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:strain: SJ_XTL219; Vector Types:CRISPR; Bacterial Resistance:Other
References:
Comments: THIS IS A STRAIN.
SJ_XTL219 is an E.coli K12 derivative of MG1655. It contains a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-dCas9 protein over two orders of magnitude in a plasmid-free system. This tCRISPRi is reversible, and gene expression can be repressed or restored by adding or withdrawing arabinose. This tCRISPRi strain has less than 10% leaky expression. Most importantly from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering to add the sgRNA. This tCRISPRi strain, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries.
Proper citation: RRID:Addgene_86400 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
