Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBC083 Resource Report Resource Website |
RRID:Addgene_202242 | bc110 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:32 | 0 | |
|
pBC129 Resource Report Resource Website |
RRID:Addgene_202256 | bc156 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC128 Resource Report Resource Website |
RRID:Addgene_202255 | bc155 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC134 Resource Report Resource Website |
RRID:Addgene_202261 | bc161 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC135 Resource Report Resource Website |
RRID:Addgene_202262 | bc162 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
KJ740(DE3) Resource Report Resource Website |
RRID:Addgene_179486 | none | Other | Other | PMID:35639414 | λDE3 [lacI, lacUV5-T7 gene 1, ind1, sam7, nin5] F- araC14 fhuA31 lacY1 tsx-78 ΔompF480 zcb-222::Tn10 rfbC1 mgl-51 ΔompC178 rpsL136(StrR) xylA5 mtl-1 thiE1 KJ740(DE3) is a λDE3 derivative of the OmpC- & OmpF-deficient strain KJ740 that was described in Ingham C, Buechner M, Adler J, 1990, J Bacteriol 172:3577-3583. Due to the presence of the lambda (DE3) lysogen, KJ740(DE3) is compatible with expression from the T7 promoter. The (DE3) lysogen of the parent strain KJ740 was made by Debra T. Hansen using the λDE3 Lysogenization Kit 538 (EMD Millipore #69734-3). The parent strain KJ740 was obtained from the Yale E. coli Genetic Stock Center (CGSC) as strain number 12151. In contrast to BL21 derivative strains, KJ740(DE3) is not deficient in the proteases Lon and OmpT. The presence of (DE3) was confirmed by PCR by Felicia M. Craciunescu. PCR primers that may be used to verify the presence of the (DE3) lysogen: These primer pairs are expected to generate a PCR product from each of 3 genes within the (DE3) sequence, GenBank accession no. AM946981.2. There are two primer pairs per gene, therefore 6 possible PCR products. The presence of the PCR product of the expected size indicates the presence of the (DE3) lysogen. The PCR reactions will also be run on the negative control non-(DE3) parent strain, KJ740, which is expected to not generate these PCR product sizes. gene A F1 GACTACATCCGTGAGGTGAATGTGG gene A R1 GATGACGCAGGCATTATGCTCGCAG Product size = 645 bp gene A F2 CCTTTCACATCTGGACAGCGTACAG gene A R2 GTTGCTGCACCATCCTCTTCCTGC Product size = 904 bp gene H F1 GACATCTGGAATCTGCGCAAGGATGA gene H R1 CTGCAGGATTTTCCCGTCTTTCAGTG Product size = 291 bp gene H F2 GTGCGCTGGCGTATGCCTGGTATC gene H R2 CTGTTCCGTGGCTTCCCGTTCTGC Product size = 1388 bp gene J F1 CTTTACCTTCGGTGTACAGGCACTGGTG gene J R1 GTCCTGCACGAACGTCAGCGTCTG Product size = 748 bp gene J F2 CAGACAGGTTGAAACCAGCACGCGTTATC gene J R2 GTTTGCCTTCCTCCGTGTCCTCCATG Product size = 407 bp Please visit https://www.biorxiv.org/content/10.1101/2021.08.26.457821v2 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Other | 2024-02-11 12:03:46 | 0 | |
|
ATMW1 Resource Report Resource Website |
RRID:Addgene_218768 | EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK | Other | Other | PMID:28192410 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-08-01 01:07:04 | 0 | ||
|
ATMW-BL21 Resource Report Resource Website |
RRID:Addgene_218769 | pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR | Other | Other | PMID:34655653 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-08-01 01:07:04 | 0 | ||
|
psBIG1b Resource Report Resource Website |
RRID:Addgene_229958 | Other | PMID: | Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint. | Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other | 2025-02-21 01:09:00 | 0 | |||
|
psBIG1c Resource Report Resource Website |
RRID:Addgene_229959 | Other | PMID: | Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint. | Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other | 2025-02-21 01:09:00 | 0 | |||
|
pBMTL-6 Resource Report Resource Website |
RRID:Addgene_22816 | Other | PMID:16496398 | Backbone Size:5922; Vector Backbone:pBMTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | ||||
|
pBTL-6 Resource Report Resource Website |
RRID:Addgene_22810 | Other | PMID:16496398 | Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity. | Backbone Size:4677; Vector Backbone:pBTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | |||
|
pBT-6 Resource Report Resource Website |
RRID:Addgene_22829 | Other | PMID:16496398 | Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity. | Backbone Size:4617; Vector Backbone:pBT-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | |||
|
pBTB-6 Resource Report Resource Website |
RRID:Addgene_22822 | Other | PMID:16496398 | Backbone Size:5799; Vector Backbone:pBTB-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | ||||
|
S4246 Resource Report Resource Website |
RRID:Addgene_156372 | Other | PMID:33500394 | For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites Depositor recomments the following primers to sequence the relevant regions: gaaattccttgtcgggtaagttcc gaacatcaaacattaaagggtggtatttc Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification. Protocol for the digestion reaction: For 50 uL reaction: 1 ug DNA 5 uL CutSmart 1 uL HpyCH4III Up to 50 uL MQ water Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Other | 2022-04-22 03:29:09 | 0 | |||
|
pF2 Resource Report Resource Website |
RRID:Addgene_42520 | Other | PMID:23437314 | Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | ||||
|
pF2-DTA Resource Report Resource Website |
RRID:Addgene_42521 | EF1a-DTA | Other | PMID:23437314 | Vector Backbone:pF2; Vector Types:Mouse Targeting; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | |||
|
pF Resource Report Resource Website |
RRID:Addgene_42519 | Other | PMID:23437314 | Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | ||||
|
MIP 247 CoMiP 4in1 with shRNA p53 Resource Report Resource Website 1+ mentions |
RRID:Addgene_63726 | Mini-intronic-plasmid intron | Homo sapiens | Other | PMID:25628230 | In addition to the publication listed above, more details can be found in Lu, et al. Mol Ther. 2013, PMID 23459514. | Backbone Marker:Joseph Wu's Lab at Stanford University; Backbone Size:8062; Vector Backbone:codon-optimized minicircle (CoMiC) construct; Vector Types:Mammalian Expression; Bacterial Resistance:Other | codon-optimised | 2022-04-22 03:46:13 | 1 |
|
Jun lab tunable CRISPRi strain Resource Report Resource Website |
RRID:Addgene_86400 | Other | PMID:27996021 | THIS IS A STRAIN. SJ_XTL219 is an E.coli K12 derivative of MG1655. It contains a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-dCas9 protein over two orders of magnitude in a plasmid-free system. This tCRISPRi is reversible, and gene expression can be repressed or restored by adding or withdrawing arabinose. This tCRISPRi strain has less than 10% leaky expression. Most importantly from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering to add the sgRNA. This tCRISPRi strain, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries. | Vector Backbone:strain: SJ_XTL219; Vector Types:CRISPR; Bacterial Resistance:Other | 2022-04-22 03:52:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
