Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-nEF-Coff/Fon-ChRmine-oScarlet Resource Report Resource Website |
RRID:Addgene_137160 | Coff/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2024-08-01 01:02:23 | 0 |
|
pKD077 Resource Report Resource Website |
RRID:Addgene_136473 | SSB-mTur2 | Other | Ampicillin | PMID:32374866 | Backbone Size:5382; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | mTurquoise2 inserted between Phe148 and Ser149 | 2024-08-01 01:02:21 | 0 | |
|
pLX-TRE-dCas9-KRAB-MeCP2-BSD Resource Report Resource Website |
RRID:Addgene_140690 | Cas9m4-KRAB-MeCP2 | Synthetic | Ampicillin | PMID: | This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection. | Backbone Marker:Andrea Califano; Vector Backbone:PB-TRE-dCas9-KRAB-MeCP2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:34 | 0 | |
|
pCDNA4.TO-ORF73-2xCSTREP Resource Report Resource Website |
RRID:Addgene_136232 | ORF73 | Other | Ampicillin | PMID:25544563 | Backbone Marker:Invitrogen; Vector Backbone:pCDNA4.TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:20 | 0 | ||
|
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1 Resource Report Resource Website |
RRID:Addgene_159905 | Slc32a1 | Mus musculus | Ampicillin | PMID: | Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:03:36 | 0 | ||
|
pUPD2 SV40-AcrIIA4 (GB3333) Resource Report Resource Website |
RRID:Addgene_160605 | AcrIIA4 | Synthetic | Chloramphenicol | PMID:34632687 | Compatible with GoldenBraid; insert can be released with BsaI | Backbone Marker:self-made; derived from the BioBrick assembly plasmid pSB1C3 ; Vector Backbone:pUPD2; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pVD1 Multiplexing Edit En-1 (GB2242) Resource Report Resource Website |
RRID:Addgene_160564 | Multiplexing Edit (En-1) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pDONR221-SLC25A39_STOP Resource Report Resource Website |
RRID:Addgene_161136 | SLC25A39 | Homo sapiens | Kanamycin | PMID:32265506 | This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131970 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:03:40 | 0 | |
|
pVD1 tRNA-gRNA E4-En-1 (GB2243) Resource Report Resource Website |
RRID:Addgene_160565 | tRNA-gRNA position E4-En-1 (Multiplexing Edit) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244) Resource Report Resource Website |
RRID:Addgene_160566 | Multiplexing Edit (E3-E4-En-1) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pGT2 Resource Report Resource Website |
RRID:Addgene_13056 | Ampicillin | PMID:17113027 | pGT2 is an XcmI generated T-vector bearing GFP marker optimized for direct cloning. Colonies with insert are selected by GFP inactivation. | Backbone Size:3267; Vector Backbone:pGT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:02 | 0 | |||
|
pFLAG-ING2 Resource Report Resource Website |
RRID:Addgene_13295 | ING2 | Homo sapiens | Ampicillin | PMID:16024799 | Cloning site sequence is TCAGATCC ATG...ING2...TAGTA GAATTC TGCA GATATC. | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV-6c; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:10 | 0 | |
|
pcDNA3-ING2 Resource Report Resource Website |
RRID:Addgene_13294 | ING2 | Homo sapiens | Ampicillin | PMID:16024799 | Cloning site sequence is GGATCC ATG...ING2...TAGTA GAATTC. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:10 | 0 | |
|
pCS4333 yeTadA1.0-T7 RNAP Resource Report Resource Website |
RRID:Addgene_137735 | yeTadA1.0-T7 RNAP | Saccharomyces cerevisiae | Ampicillin | PMID:33707425 | Depositor confirms E366G does not affect plasmid function. | Backbone Size:5600; Vector Backbone:ColE1/AMP; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | E366G (See depositor comment below) | 2024-08-01 01:02:24 | 0 |
|
Cav1-mRFP Resource Report Resource Website |
RRID:Addgene_14434 | Caveolin-1 | Canis familalis | Kanamycin | PMID:16129785 | Please note that the depositing laboratory recommends using CAV1-mCherry (Addgene Plasmid #27705) instead of CAV1-mRFP due to improved properties of the mCherry fluorophore. | Backbone Size:4687; Vector Backbone:pmRFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:47 | 0 | |
|
Cav1-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_14433 | Caveolin-1 | Canis familalis | Kanamycin | PMID:16129785 | Backbone Marker:Clontech; Backbone Size:4749; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:47 | 3 | ||
|
lenti-SAM-hygro Resource Report Resource Website |
RRID:Addgene_138955 | Ampicillin | PMID:31973890 | Backbone Size:9576; Vector Backbone:UGPC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:28 | 0 | ||||
|
UGPC Resource Report Resource Website |
RRID:Addgene_138954 | Ampicillin | PMID:31973890 | Vector Backbone:N/A; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:28 | 0 | ||||
|
pPB CAG SMARCA4 T910M-IRES-EGFP Resource Report Resource Website |
RRID:Addgene_153949 | SMARCA4 | Homo sapiens | Ampicillin | PMID:31996670 | Backbone Size:7582; Vector Backbone:PiggyBac transposon; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T910M | 2024-08-01 01:03:16 | 0 | |
|
pPB CAG SMARCA4-IRES-EGFP Resource Report Resource Website |
RRID:Addgene_153948 | SMARCA4 | Homo sapiens | Ampicillin | PMID:31996670 | Backbone Size:7582; Vector Backbone:PiggyBac transposon; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:03:16 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
