Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99654 Copy
Species: Homo sapiens
Genetic Insert: FMR1
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: CGG repeats are moderately unstable in prolonged bacterial culture at 37C. Upon receipt select several colonies and grow overnight. Immediately make glycerol stocks and verify the insert size. Inoculate directly from glycerol and grow for ~10 hours for large scale preparations.
Proper citation: RRID:Addgene_99257 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99655 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99657 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99659 Copy
Species:
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99265 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99663 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99664 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99666 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99669 Copy
Species: Mus musculus
Genetic Insert: LucA
Vector Backbone Description: Backbone Marker:Addgene plasmid #20905; Vector Backbone:Luc.Cre empty vector; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Visit https://dx.doi.org/10.2139/ssrn.3770111 for the preprint.
Proper citation: RRID:Addgene_174047 Copy
Species: Mus musculus
Genetic Insert: LucL
Vector Backbone Description: Backbone Marker:Addgene plasmid #20905; Vector Backbone:Luc.Cre empty vector; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Visit https://dx.doi.org/10.2139/ssrn.3770111 for the preprint.
Proper citation: RRID:Addgene_174048 Copy
Species: Other
Genetic Insert: Cas9, Drm1b gRNA
Vector Backbone Description: Vector Backbone:pTRANS_250d; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_185688 Copy
Species: Other
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions
Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)
Proper citation: RRID:Addgene_191530 Copy
Species: Other
Genetic Insert: AAEL003877-dCAS9-VPR
Vector Backbone Description: Backbone Size:5246; Vector Backbone:Plasmid #100581; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_183993 Copy
Species: Bos taurus
Genetic Insert: GPCR activation based oxytocin sensor GRAB_OT1.0
Vector Backbone Description: Backbone Size:4495; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.10.480016v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_185386 Copy
Species: Caenorhabditis elegans
Genetic Insert: Caenorhabditis elegans CNNM3 CBS-pair domain
Vector Backbone Description: Backbone Marker:Amersham-Pharmacia; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_166510 Copy
Species: Mus musculus
Genetic Insert: FGF13/FHF2, B isoform (Homo sapiens) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2922737.
Proper citation: RRID:Addgene_190541 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG )
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99690 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99691 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
