Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
dSp-p65 Full (1-261) Resource Report Resource Website |
RRID:Addgene_99654 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:44 | 0 |
|
pGLACTE-PseudoHT51 Resource Report Resource Website |
RRID:Addgene_99257 | FMR1 | Homo sapiens | Ampicillin | PMID:28818679 | CGG repeats are moderately unstable in prolonged bacterial culture at 37C. Upon receipt select several colonies and grow overnight. Immediately make glycerol stocks and verify the insert size. Inoculate directly from glycerol and grow for ~10 hours for large scale preparations. | Vector Backbone:pGL3; Vector Types:; Bacterial Resistance:Ampicillin | Contains synthetic, non-human, primer sequence downstream of CGG repeats | 2024-08-01 01:10:43 | 0 |
|
dSp-p65 (150-261) Resource Report Resource Website |
RRID:Addgene_99655 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:44 | 0 |
|
dSp-p65 (200-261) Resource Report Resource Website |
RRID:Addgene_99657 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:44 | 0 |
|
dSp-p65 (1-150) Resource Report Resource Website |
RRID:Addgene_99659 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
pCS2+ H2B-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_99265 | mCherry | Ampicillin | PMID:31564455 | Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:10:43 | 1 | |||
|
dSp-Rta 75-190 Resource Report Resource Website |
RRID:Addgene_99663 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
dSp-Rta 125-190 Resource Report Resource Website |
RRID:Addgene_99664 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
dSp-Rta 75-175 Resource Report Resource Website |
RRID:Addgene_99666 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
dSp-VP64-RTA(75-190) Resource Report Resource Website |
RRID:Addgene_99669 | dCas9 | Synthetic | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
Lenti-LucA Resource Report Resource Website |
RRID:Addgene_174047 | LucA | Mus musculus | Ampicillin | PMID:34534464 | Visit https://dx.doi.org/10.2139/ssrn.3770111 for the preprint. | Backbone Marker:Addgene plasmid #20905; Vector Backbone:Luc.Cre empty vector; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, Luciferase; Bacterial Resistance:Ampicillin | ALG8 alanine 506 to threonine | 2024-08-01 01:04:25 | 0 |
|
Lenti-LucL Resource Report Resource Website |
RRID:Addgene_174048 | LucL | Mus musculus | Ampicillin | PMID:34534464 | Visit https://dx.doi.org/10.2139/ssrn.3770111 for the preprint. | Backbone Marker:Addgene plasmid #20905; Vector Backbone:Luc.Cre empty vector; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, Luciferase; Bacterial Resistance:Ampicillin | LAMA4 glycine 1254 to valine | 2024-08-01 01:04:25 | 0 |
|
pTW037 Resource Report Resource Website |
RRID:Addgene_185688 | Cas9, Drm1b gRNA | Other | Kanamycin | PMID:32786122 | Vector Backbone:pTRANS_250d; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin | 2024-08-01 01:05:02 | 0 | ||
|
bSLS.114 Resource Report Resource Website |
RRID:Addgene_191530 | E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 | Other | None | PMID:34949838 | Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon) | Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None | 2024-08-01 01:05:20 | 0 | |
|
OA-986F (AAEL003877-dCas9-VPR) Resource Report Resource Website |
RRID:Addgene_183993 | AAEL003877-dCAS9-VPR | Other | Ampicillin | PMID:36656895 | Backbone Size:5246; Vector Backbone:Plasmid #100581; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:04:55 | 0 | ||
|
pAAV-hSyn-GRAB_OT1.0 Resource Report Resource Website |
RRID:Addgene_185386 | GPCR activation based oxytocin sensor GRAB_OT1.0 | Bos taurus | Ampicillin | PMID:36593404 | Please visit https://www.biorxiv.org/content/10.1101/2022.02.10.480016v1.full for bioRxiv preprint. | Backbone Size:4495; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:01 | 0 | |
|
pGEX-6P-1 Caenorhabditis elegans CNNM3 CBS-pair domain Resource Report Resource Website |
RRID:Addgene_166510 | Caenorhabditis elegans CNNM3 CBS-pair domain | Caenorhabditis elegans | Ampicillin | PMID:36822330 | Backbone Marker:Amersham-Pharmacia; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:04:01 | 0 | ||
|
FGF13/FHF2, B isoform scFv [N225A/10] Resource Report Resource Website |
RRID:Addgene_190541 | FGF13/FHF2, B isoform (Homo sapiens) recombinant scFV | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2922737. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:16 | 0 | |
|
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1 Resource Report Resource Website |
RRID:Addgene_99690 | dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) | Mus musculus | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
|
pAAV-CMV-dSa VP64 Actc1 Resource Report Resource Website |
RRID:Addgene_99691 | dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) | Mus musculus | Ampicillin | PMID: | Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. | Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | dead Cas9 | 2024-08-01 01:10:45 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
