Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

718,359 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
P0050::kaiBC
 
Resource Report
Resource Website 		RRID:Addgene_101828 kanamycin casette and p0050 promoter Other Kanamycin PMID:28430105 Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Other, Cloning vector; Bacterial Resistance:Kanamycin 2022-04-22 03:15:10 0
pMZ0002
 
Resource Report
Resource Website 		RRID:Addgene_102239 N-ethylmaleimide sensitive factor Other Ampicillin PMID:25581794 Vector Backbone:pPROEX1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
pET_BGL3
 
Resource Report
Resource Website 		RRID:Addgene_101912 β-glucosidase Other Ampicillin PMID:29516725 Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
pET_BGL1
 
Resource Report
Resource Website 		RRID:Addgene_101910 β-glucosidase Other Ampicillin PMID:29516725 Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
pET_BGL2
 
Resource Report
Resource Website 		RRID:Addgene_101911 β-glucosidase Other Ampicillin PMID:29516725 Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
Bassik lab Human CRISPR-Cas9 Deletion Library - Gene Expression
 
Resource Report
Resource Website 		RRID:Addgene_101928 Ampicillin PMID:28474669 Backbone Marker:Bassik lab (Addgene Plasmid #89359); Vector Backbone:pMCB320; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
5JJW (USP15_SART3)
 
Resource Report
Resource Website 		RRID:Addgene_101880 USP15_SART3 Homo sapiens Kanamycin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SART3|USP15:YTC044-A09:C237276. SGC or PDG link: http://www.thesgc.org/structures/5JJW/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2022-04-22 03:15:11 0
5KCH (SETDB1)
 
Resource Report
Resource Website 		RRID:Addgene_101881 SETDB1 Homo sapiens Kanamycin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETDB1:APC043-C07:C27642. SGC or PDG links: 5KCH http://www.thesgc.org/structures/5KCH/ 6AU2 http://www.thesgc.org/structures/6AU2/ 6AU3 http://www.thesgc.org/structures/6AU3/ 6BPI http://www.thesgc.org/structures/6BPI/ 5KCO http://www.thesgc.org/structures/5KCO/ 5KE2 http://www.thesgc.org/structures/5KE2/ 5KE3 http://www.thesgc.org/structures/5KE3/ 5KH6 http://www.thesgc.org/structures/5KH6/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2022-04-22 03:15:11 0
5T5G (SETD8)
 
Resource Report
Resource Website 		RRID:Addgene_101886 SETD8 Homo sapiens Kanamycin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETD8:PBC001-G01:C233009. SGC or PDG link: http://www.thesgc.org/structures/5T5G/ http://www.thesgc.org/structures/5TH7/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2022-04-22 03:15:11 0
5TCK (PP-BRD3)
 
Resource Report
Resource Website 		RRID:Addgene_101887 PP-BRD3 Other Ampicillin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-F01:C235018. SGC or PDG link: http://www.thesgc.org/structures/5TCK/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:11 0
5TCM (PP-BRD3)
 
Resource Report
Resource Website 		RRID:Addgene_101888 PP-BRD3 Other Ampicillin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-C02:C235023. SGC or PDG links: http://www.thesgc.org/structures/5TCM/ http://www.thesgc.org/structures/6BYA/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
5TF2 (PREB)
 
Resource Report
Resource Website 		RRID:Addgene_101889 PREB Homo sapiens Ampicillin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: PREB:YTC012-F10:C229890. SGC or PDG link: http://www.thesgc.org/structures/5TF2/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Other, Baculovirus expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 0
5KO4 (PP-BRD19)
 
Resource Report
Resource Website 		RRID:Addgene_101882 PP-BRD19 Other Ampicillin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: Tb427.10.8150:MAC054-H04:C234720. SGC or PDG link: http://www.thesgc.org/structures/5KO4/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:11 0
pTRE2-Bla(HA–RILP)
 
Resource Report
Resource Website 		RRID:Addgene_102425 Rab interacting lysosomal protein Homo sapiens Ampicillin PMID:27791088 Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:15 0
pPB-CAG-rtTA-IRES-Hygro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102423 tetracyclin-transactivator (rtTA) Ampicillin PMID:28504700 IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:15 2
p2lox-cAMPr R626A
 
Resource Report
Resource Website 		RRID:Addgene_102437 cAMPr Ampicillin PMID:29511120 Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin PKA-R R626A 2022-04-22 03:15:15 0
p2lox-cAMPr Y205A
 
Resource Report
Resource Website 		RRID:Addgene_102438 cAMPr Ampicillin PMID:29511120 Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin PKA-C Y205A 2022-04-22 03:15:15 0
pcDNA3.1-hSNCA-NE
 
Resource Report
Resource Website 		RRID:Addgene_102361 synuclein alpha Homo sapiens Ampicillin PMID:30983487 This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/) Backbone Marker:Invitrogen; Backbone Size:5900; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:14 0
UBI10:RFP-RabG3B-WT
 
Resource Report
Resource Website 		RRID:Addgene_102369 RabG3B Arabidopsis thaliana Spectinomycin PMID: Vector Backbone:pUBN-RFP; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2022-04-22 03:15:14 0
mAzami-Green-Galectin
 
Resource Report
Resource Website 		RRID:Addgene_102419 LGALS3 Homo sapiens Ampicillin PMID:26907999 The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green. Backbone Marker:Invitrogen; Vector Backbone:pcDNA6-myc his version B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:14 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch