Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062741 | Caenorhabditis elegans | src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. | juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https: | WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14) | WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14) | WB-STRAIN:WBStrain00062741 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:32:17 | 0 | |||
|
dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055739 | Caenorhabditis elegans | dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. | This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00055739 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:18 | 0 | |||
|
rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00052039 | Caenorhabditis elegans | rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. | Made_by: UDN Screening Center|"rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658" | WBGene00001067(dpy-5)|WBGene00004268(rab-5) | WBGene00001067(dpy-5), WBGene00004268(rab-5) | WB-STRAIN:WBStrain00052039 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:24 | 0 | |||
|
BC196 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00000478 | Caenorhabditis elegans | dpy-5(e61) dpy-14(e188) rec-1(s180) I. | Dpy. Best maintained at 16C (dpy-14 is ts). High recombination. | WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1) | WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1) | WB-STRAIN:WBStrain00000478 | WormBase (WB) | WB | available | PMID:492325 | WB-STRAIN:BC196, CGC_BC196 | 2026-02-07 12:15:35 | 0 | ||
|
BC159 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00000471 | Caenorhabditis elegans | dpy-5(e61) unc-13(e51) I; sDp1 (I;f). | Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Segregates 2% males. The males are sterile. The duplication is homozygous lethal.|"Mutagen:Gamma ray" | WBGene00001067(dpy-5)|WBGene00006752(unc-13) | WBGene00001067(dpy-5), WBGene00006752(unc-13) | WB-STRAIN:WBStrain00000471 | WormBase (WB) | WB | available | PMID:6593563 | WB-STRAIN:BC159, CGC_BC159 | 2026-02-07 12:15:35 | 0 | ||
|
BA979 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00000418 | Caenorhabditis elegans | dpy-5(e61) spe-12(hc76) I; spe-6(hc163) III. | spe-6(hc163) suppresses hermaphrodite self-sterility of hc76. Dpy. | WBGene00001067(dpy-5)|WBGene00004960(spe-6)|WBGene00004966(spe-12) | WBGene00001067(dpy-5), WBGene00004960(spe-6), WBGene00004966(spe-12) | WB-STRAIN:WBStrain00000418 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BA979, CGC_BA979 | 2026-02-07 12:15:35 | 0 | ||
|
BC10066 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001149 | Caenorhabditis elegans | dpy-5(e907) I; sEx900. | Made_by: Reza Pourvali|"sEx900 [rCesC15H9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001149 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10066, CGC_BC10066 | 2026-02-07 12:15:42 | 0 | ||
|
BC10060 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001143 | Caenorhabditis elegans | dpy-5(e907) I; sEx884. | Made_by: Reza Pourvali|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"sEx884 [rCesC12C8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001143 | WormBase (WB) | WB | available | PMID:31704915 | WB-STRAIN:BC10060, CGC_BC10060 | 2026-02-07 12:15:42 | 0 | ||
|
BC10062 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001145 | Caenorhabditis elegans | dpy-5(e907) I; sEx890. | Made_by: Reza Pourvali|"sEx890 [rCesF11F1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001145 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10062, CGC_BC10062 | 2026-02-07 12:15:42 | 0 | ||
|
BC10089 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001160 | Caenorhabditis elegans | dpy-5(e907) I; sEx10089. | sEx10089 [rCesF22E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001160 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10089, CGC_BC10089 | 2026-02-07 12:15:42 | 0 | ||
|
BC10077 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001156 | Caenorhabditis elegans | dpy-5(e907) I; sEx10077. | sEx10077 [rCesF56C9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00001748(gsp-2) | WBGene00001067(dpy-5), WBGene00001748(gsp-2) | WB-STRAIN:WBStrain00001156 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10077, CGC_BC10077 | 2026-02-07 12:15:42 | 0 | ||
|
BC10116 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001174 | Caenorhabditis elegans | dpy-5(e907) I; sEx10116. | sEx10116 [rCesF56B6.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001174 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10116, CGC_BC10116 | 2026-02-07 12:15:42 | 0 | ||
|
BC10113 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001173 | Caenorhabditis elegans | dpy-5(e907) I; sEx10113. | sEx10113 [rCesF46B6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00009772(ztf-7) | WBGene00001067(dpy-5), WBGene00009772(ztf-7) | WB-STRAIN:WBStrain00001173 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10113, CGC_BC10113 | 2026-02-07 12:15:42 | 0 | ||
|
BC10105 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001169 | Caenorhabditis elegans | dpy-5(e907) I; sEx10105. | sEx10105 [rCesZk470.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00001169 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10105, CGC_BC10105 | 2026-02-07 12:15:42 | 0 | ||
|
BC10100 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001165 | Caenorhabditis elegans | dpy-5(e907) I; sEx10100. | sEx10100 [rCes C26E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00016140(rpb-2) | WBGene00001067(dpy-5), WBGene00016140(rpb-2) | WB-STRAIN:WBStrain00001165 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10100, CGC_BC10100 | 2026-02-07 12:15:42 | 0 | ||
|
BC10154 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001200 | Caenorhabditis elegans | dpy-5(e907) I; sEx10154. | sEx10154 [rCes T05B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00020246(clic-1) | WBGene00001067(dpy-5), WBGene00020246(clic-1) | WB-STRAIN:WBStrain00001200 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10154, CGC_BC10154 | 2026-02-07 12:15:43 | 0 | ||
|
BC10101 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001166 | Caenorhabditis elegans | dpy-5(e907) I; sEx10101. | sEx10101 [rCesF37A4.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00002169(isw-1) | WBGene00001067(dpy-5), WBGene00002169(isw-1) | WB-STRAIN:WBStrain00001166 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10101, CGC_BC10101 | 2026-02-07 12:15:42 | 0 | ||
|
BC10131 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001185 | Caenorhabditis elegans | dpy-5(e907) I; sEx10131. | sEx10131 contains [rCes DH11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00008435(glna-2) | WBGene00001067(dpy-5), WBGene00008435(glna-2) | WB-STRAIN:WBStrain00001185 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10131, CGC_BC10131 | 2026-02-07 12:15:42 | 0 | ||
|
BC10128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001184 | Caenorhabditis elegans | dpy-5(e907) I; sEx10128. | sEx10128 [rCes ZC395.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00006590(toc-1) | WBGene00001067(dpy-5), WBGene00006590(toc-1) | WB-STRAIN:WBStrain00001184 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10128, CGC_BC10128 | 2026-02-07 12:15:42 | 0 | ||
|
BC10124 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00001181 | Caenorhabditis elegans | dpy-5(e907) I; sEx10124. | sEx10124 [rCes F56B3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). | WBGene00001067(dpy-5)|WBGene00001154(ech-5) | WBGene00001067(dpy-5), WBGene00001154(ech-5) | WB-STRAIN:WBStrain00001181 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:BC10124, CGC_BC10124 | 2026-02-07 12:15:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
