Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Sh2b3em1Mcwi Resource Report Resource Website |
RRID:RGD_4139885 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. | 4139885 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 4139885 | 2026-02-14 03:49:53 | 0 | |||||
|
SS-Acad10em2Mcwi Resource Report Resource Website |
RRID:RGD_5131910 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2. | 5131910 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5131910 | 2026-02-14 03:49:55 | 0 | |||||
|
FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi-/- Resource Report Resource Website |
RRID:RGD_5688087 | Rattus norvegicus | ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. | 5688087 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5688087 | 2026-02-14 03:49:56 | 0 | |||||
|
SS-Agtr1aem1Mcwi Resource Report Resource Website |
RRID:RGD_5685369 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3. | 5685369 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5685369 | 2026-02-14 03:49:55 | 0 | |||||
|
SS-Clcn6em2Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_6484573 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13. | 6484573 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 6484573 | 2026-02-14 03:49:56 | 1 | |||||
|
SS-Sh2b3em1Mcwi-/- Resource Report Resource Website |
RRID:RGD_5686318 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 . | 5686318 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 5686318 | 2026-02-14 03:49:57 | 0 | |||||
|
WKY-Trpv2em1Mcwi Resource Report Resource Website |
RRID:RGD_11553899 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 11553899 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 11553899 | 2026-02-14 03:50:04 | 0 | |||||
|
SS-Vnn1em1Mcwi Resource Report Resource Website |
RRID:RGD_11553855 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu | 11553855 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 11553855 | 2026-02-14 03:50:05 | 0 | |||||
|
SS-Vnn1em2Mcwi Resource Report Resource Website |
RRID:RGD_11553852 | Rattus norvegicus | CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu | 11553852 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 11553852 | 2026-02-14 03:50:05 | 0 | |||||
|
SS.BN-(D13Rat25-rs198199323)-Btg2em21Mcwi Resource Report Resource Website |
RRID:RGD_12437069 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12437069 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12437069 | 2026-02-14 03:50:04 | 0 | |||||
|
SS-Cd14em1Mcwi Resource Report Resource Website |
RRID:RGD_12790608 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790608 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790608 | 2026-02-14 03:50:04 | 0 | |||||
|
SS-Trpc6em1Mcwi Resource Report Resource Website |
RRID:RGD_11553912 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 11553912 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 11553912 | 2026-02-14 03:50:05 | 0 | |||||
|
SS-Pon1em3Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_12790698 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790698 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790698 | 2026-02-14 03:50:05 | 1 | |||||
|
LEW-Igh-6em4Mcwi Resource Report Resource Website |
RRID:RGD_12790629 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790629 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790629 | 2026-02-14 03:50:04 | 0 | |||||
|
SD-Rag2em3Mcwi Resource Report Resource Website |
RRID:RGD_12790710 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2. | 12790710 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790710 | 2026-02-14 03:50:04 | 0 | |||||
|
PCK-P2rx7em8Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_12790679 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790679 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790679 | 2026-02-14 03:50:05 | 1 | |||||
|
WKY-Mbem6Mcwi Resource Report Resource Website |
RRID:RGD_12790662 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790662 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790662 | 2026-02-14 03:50:05 | 0 | |||||
|
WKY-Sik2em5Mcwi Resource Report Resource Website |
RRID:RGD_12790944 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 12790944 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 12790944 | 2026-02-14 03:50:04 | 0 | |||||
|
SS-Trpc6em4Mcwi Resource Report Resource Website |
RRID:RGD_11553908 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 11553908 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 11553908 | 2026-02-14 03:50:05 | 0 | |||||
|
SS-Spp1em4Mcwi Resource Report Resource Website |
RRID:RGD_13207529 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 13207529 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 13207529 | 2026-02-14 03:50:06 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.