Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Availability:cryopreserved sperm (as of 2021-11-03) (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

81 Results - per page

Show More Columns | Download 81 Result(s)

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SS-Sh2b3em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139885 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. 4139885 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 4139885 2026-02-14 03:49:53 0
SS-Acad10em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_5131910 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2. 5131910 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 5131910 2026-02-14 03:49:55 0
FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5688087 Rattus norvegicus ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 5688087 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 5688087 2026-02-14 03:49:56 0
SS-Agtr1aem1Mcwi
 
Resource Report
Resource Website
RRID:RGD_5685369 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3. 5685369 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 5685369 2026-02-14 03:49:55 0
SS-Clcn6em2Mcwi
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_6484573 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13. 6484573 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 6484573 2026-02-14 03:49:56 1
SS-Sh2b3em1Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5686318 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 . 5686318 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 5686318 2026-02-14 03:49:57 0
WKY-Trpv2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_11553899 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 11553899 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 11553899 2026-02-14 03:50:04 0
SS-Vnn1em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_11553855 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu 11553855 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 11553855 2026-02-14 03:50:05 0
SS-Vnn1em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_11553852 Rattus norvegicus CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu 11553852 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 11553852 2026-02-14 03:50:05 0
SS.BN-(D13Rat25-rs198199323)-Btg2em21Mcwi
 
Resource Report
Resource Website
RRID:RGD_12437069 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12437069 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12437069 2026-02-14 03:50:04 0
SS-Cd14em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_12790608 Rattus norvegicus The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790608 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790608 2026-02-14 03:50:04 0
SS-Trpc6em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_11553912 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 11553912 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 11553912 2026-02-14 03:50:05 0
SS-Pon1em3Mcwi
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_12790698 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790698 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790698 2026-02-14 03:50:05 1
LEW-Igh-6em4Mcwi
 
Resource Report
Resource Website
RRID:RGD_12790629 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790629 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790629 2026-02-14 03:50:04 0
SD-Rag2em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_12790710 Rattus norvegicus This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2. 12790710 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790710 2026-02-14 03:50:04 0
PCK-P2rx7em8Mcwi
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_12790679 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790679 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790679 2026-02-14 03:50:05 1
WKY-Mbem6Mcwi
 
Resource Report
Resource Website
RRID:RGD_12790662 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790662 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790662 2026-02-14 03:50:05 0
WKY-Sik2em5Mcwi
 
Resource Report
Resource Website
RRID:RGD_12790944 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 12790944 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 12790944 2026-02-14 03:50:04 0
SS-Trpc6em4Mcwi
 
Resource Report
Resource Website
RRID:RGD_11553908 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 11553908 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 11553908 2026-02-14 03:50:05 0
SS-Spp1em4Mcwi
 
Resource Report
Resource Website
RRID:RGD_13207529 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu 13207529 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 13207529 2026-02-14 03:50:06 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.