Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553860
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553860 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553886
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553886 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553881
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553881 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139874
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_4139874 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139875
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.
Proper citation: RRID:RGD_4139875 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139877
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_4139877 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143988
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5143988 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143986
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.
Proper citation: RRID:RGD_5143986 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131991
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131991 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131911
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131911 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131912
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5131912 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131989
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5131989 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131974
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.
Proper citation: RRID:RGD_5131974 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131975
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5131975 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131963
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_5131963 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131964
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131964 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131965
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131965 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144105
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5144105 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144103
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5144103 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144102
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5144102 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.