Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00063046
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: Y49E10.27(ve946[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCAGTTCTGAGGGGTTTTTTCAATATCCG ; Right flanking sequence: aggcacagatttctcaattgatttcgcatg. Y49E10.27 sgRNA A: CATAAATGAACGAACACCGC; Y49E10.27 sgRNA B: ctacaaaaaatgcggagacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063046 Copy
http://www.wormbase.org/db/get?name=WBStrain00063047
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00003162(mdh-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003162(mdh-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: +/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III.
Notes: Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063047 Copy
http://www.wormbase.org/db/get?name=WBStrain00063048
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007718(otub-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007718(otub-1)
Availability: unknown
References:
Synonyms: otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063048 Copy
http://www.wormbase.org/db/get?name=WBStrain00063086
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063086 Copy
http://www.wormbase.org/db/get?name=WBStrain00063083
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063083 Copy
http://www.wormbase.org/db/get?name=WBStrain00063298
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006745(unc-5)|WBGene00006789(unc-54)|WBGene00015551(adah-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006745(unc-5), WBGene00006789(unc-54), WBGene00015551(adah-1)
Availability: unknown
References:
Synonyms: adah-1(hd7105 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV.
Notes: Made_by: VH KO group|"Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063298 Copy
http://www.wormbase.org/db/get?name=WBStrain00063331
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063331 Copy
http://www.wormbase.org/db/get?name=WBStrain00063332
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018491(mdh-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018491(mdh-1)
Availability: unknown
References:
Synonyms: mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063332 Copy
http://www.wormbase.org/db/get?name=WBStrain00063297
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063297 Copy
http://www.wormbase.org/db/get?name=WBStrain00063335
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020718(mrps-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020718(mrps-2)
Availability: unknown
References:
Synonyms: +/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V
Notes: Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00063335 Copy
http://www.wormbase.org/db/get?name=WBStrain00063336
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022152(atg-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022152(atg-5)
Availability: unknown
References:
Synonyms: atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063336 Copy
http://www.wormbase.org/db/get?name=WBStrain00063333
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063333 Copy
http://www.wormbase.org/db/get?name=WBStrain00063334
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: Y71H2AM.6(hd7172[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063334 Copy
http://www.wormbase.org/db/get?name=WBStrain00063338
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F40G9.19(hd7183[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTACTTTCAGGCCCAAATGTGGAAATTGCG; Right flanking sequence: ACTATATGTGACATTTTGAAGAAGTAATAT. sgRNA #1: GCCTCAAGTACAAGCCTACT; sgRNA #2: TGAATAGTTGATTGGCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063338 Copy
http://www.wormbase.org/db/get?name=WBStrain00063290
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018002(twk-47)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018002(twk-47)
Availability: unknown
References:
Synonyms: twk-47(hd7097[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063290 Copy
http://www.wormbase.org/db/get?name=WBStrain00063291
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F25B3.4(hd7104[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 4130 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTGCTGCTTCTACTGCCCCCGTGTCCCG; Right flanking sequence: TGGAATAAGACGTGTCAGCTCCATATCTGT. sgRNA #1: CCGTCCAAATCTCACGTCAC; sgRNA #2: AAAGTTTCTACATCCTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063291 Copy
http://www.wormbase.org/db/get?name=WBStrain00063283
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016862(cest-32)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016862(cest-32)
Availability: unknown
References:
Synonyms: cest-32(hd7088[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 1914 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTTCGAATTTTTGAATTTTGTCACCT; Right flanking sequence: AGGATCTCGAGCTTTTGTTTTTTTTTTCAA. sgRNA #1: GAAAAGAGACTTATACAGGC; sgRNA #2: ACATTTCTCAACTCGTCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063283 Copy
http://www.wormbase.org/db/get?name=WBStrain00063281
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F26H9.5(hd7081[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063281 Copy
http://www.wormbase.org/db/get?name=WBStrain00063320
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F10D2.8(hd7153[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCTACATTCAGGGGTGTTTTTTCATATCT; Right flanking sequence: CGGCAATTGTCGCAAAAAATTTGGTGTGAC. sgRNA #1: CAAAGCTATGATGTGGTCCA; sgRNA #2: GCCAGCGTCTGTTAGAGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063320 Copy
http://www.wormbase.org/db/get?name=WBStrain00063288
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015692(ugt-25)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015692(ugt-25)
Availability: unknown
References:
Synonyms: ugt-25(hd7094[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 3226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAATACGAAGACTACGGAAACTACATTAT; Right flanking sequence: AGGTCTTGGATCAACGAATGAATTGGCTTT. sgRNA #1: TTCAGAACTAATGGGCGGAG; sgRNA #2: ACTGCATTCATGACTCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Proper citation: RRID:WB-STRAIN:WBStrain00063288 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.