Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61005
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).
Proper citation: RRID:RGD_61005 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68071
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.
Proper citation: RRID:RGD_68071 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68186
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.
Proper citation: RRID:RGD_68186 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68062
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).
Proper citation: RRID:RGD_68062 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68001
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain has an agouti mutation
Proper citation: RRID:RGD_68001 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68027
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).
Proper citation: RRID:RGD_68027 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68026
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).
Proper citation: RRID:RGD_68026 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68051
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Harrington 1962 from a stock selected by CS Hall for low open field defaecation.
Proper citation: RRID:RGD_68051 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68171
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: No further information
Proper citation: RRID:RGD_68171 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68172
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: No further information.
Proper citation: RRID:RGD_68172 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68157
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).
Proper citation: RRID:RGD_68157 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631182
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.
Proper citation: RRID:RGD_631182 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728186
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.
Proper citation: RRID:RGD_728186 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631283
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.
Proper citation: RRID:RGD_631283 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_4139879 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5508371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_5509997 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687974
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.
Proper citation: RRID:RGD_5687974 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687992
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687992 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687987
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5687987 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
