Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520215
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos. This strain is maintained at Rat Resource and Research Center.
Proper citation: RRID:RGD_150520215 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520217
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. This strain is maintained at Rat Resource and Research Center.
Proper citation: RRID:RGD_150520217 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39457947
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk.
Proper citation: RRID:RGD_39457947 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599147
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.
Proper citation: RRID:RGD_38599147 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38548914
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2.
Proper citation: RRID:RGD_38548914 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38548916
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915).
Proper citation: RRID:RGD_38548916 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394526
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_25394526 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429707
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system containing two pairs of single guide RNA
(sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG-
TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC-
39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39;
reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT)
insertion into exon 6 of CYP2C11 and resulting in the knockout allele.
Proper citation: RRID:RGD_150429707 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14985210
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8.
Proper citation: RRID:RGD_14985210 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925139
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats
Proper citation: RRID:RGD_126925139 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404651
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.
Proper citation: RRID:RGD_41404651 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41408339
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame.
Proper citation: RRID:RGD_41408339 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404646
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos.
Proper citation: RRID:RGD_41404646 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38508893
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus.
Proper citation: RRID:RGD_38508893 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14696715
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene.
Proper citation: RRID:RGD_14696715 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429634
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats
from the National BioResource Project-Rat
were intercrossed to produce F1 hybrids and then to obtain F2 progeny.
Rats homozygous for both Aspa and Hcn1 knockout
alleles were selected from among F2 progeny and were
used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double-
knockout strain.
Proper citation: RRID:RGD_150429634 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394485
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)
Proper citation: RRID:RGD_14394485 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429960
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Sequencing of the full-length Wwox transcript identified a 13-bp deletion in exon 9 in lde/lde rats. This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal.
Proper citation: RRID:RGD_150429960 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19259464
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NCrl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats.
Proper citation: RRID:RGD_19259464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925992
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification.
Proper citation: RRID:RGD_126925992 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
