Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413852
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_10413852 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040980
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2017-05-02)
References:
Synonyms:
Notes: By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040980 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10450489
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_10450489 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413858
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_10413858 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402822
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_10402822 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11041108
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm
References:
Synonyms:
Notes: The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11041108 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040527
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_11040527 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040525
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_11040525 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553899
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553899 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040950
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-07-12)
References:
Synonyms:
Notes: This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/Kyo National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040950 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040957
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm
References:
Synonyms:
Notes: This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation(R271C). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040957 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402819
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_10402819 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401845
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.
Proper citation: RRID:RGD_10401845 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040946
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-06-08)
References:
Synonyms:
Notes: This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/Stm National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040946 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040977
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-08-08)
References:
Synonyms:
Notes: CAG-GFP vector was knock-in into the rat ROSA26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040977 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040969
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo
References:
Synonyms:
Notes: derived from Wistar Hannover GALAS rats National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_11040969 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553858
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553858 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553855
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553855 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553852
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553852 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12879394
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2017-04-18)
References:
Synonyms:
Notes: This strain is an Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P))rat and was established by ENU mutagenesis using F344/NSlc strain. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_12879394 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.