Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Lrp5em2Vari Resource Report Resource Website |
RRID:RGD_41404648 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. | 41404648 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41404648 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Myh7bem1Blar-/- Resource Report Resource Website |
RRID:RGD_126925952 | Rattus norvegicus | The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. | 126925952 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925952 | 2026-02-14 03:50:08 | 0 | |||||
|
SS-Per1em3Mcwi Resource Report Resource Website |
RRID:RGD_13825147 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 13825147 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13825147 | 2026-02-14 03:50:07 | 0 | |||||
|
DA-Tph2em3Mcwi+/- Resource Report Resource Website |
RRID:RGD_14394617 | Rattus norvegicus | The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. | 14394617 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394617 | 2026-02-14 03:50:09 | 0 | |||||
|
W-Cyp27b1em1Thka Resource Report Resource Website |
RRID:RGD_124713544 | Rattus norvegicus | This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes. | 124713544 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 124713544 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Shank2em13Sage Resource Report Resource Website |
RRID:RGD_126790496 | Rattus norvegicus | The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA | 126790496 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126790496 | 2026-02-14 03:50:08 | 0 | |||||
|
W-Vdrem2Thka Resource Report Resource Website |
RRID:RGD_124713548 | Rattus norvegicus | This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes. | 124713548 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 124713548 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Cd59em1Ask-/- Resource Report Resource Website 1+ mentions |
RRID:RGD_13792606 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. | 13792606 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792606 | 2026-02-14 03:50:08 | 1 | |||||
|
SD-Leprem4Lizh Resource Report Resource Website |
RRID:RGD_21079475 | Rattus norvegicus | The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR. | 21079475 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 21079475 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Abcc6em2Qlju+/- Resource Report Resource Website |
RRID:RGD_13792682 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 13792682 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792682 | 2026-02-14 03:50:07 | 0 | |||||
|
WI-Pmchm1Hubr Resource Report Resource Website |
RRID:RGD_150429963 | Rattus norvegicus | The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. | 150429963 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429963 | 2026-02-14 03:50:08 | 0 | |||||
|
Lew-Glp1rem1Mcwi Resource Report Resource Website |
RRID:RGD_13800749 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 13800749 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800749 | 2026-02-14 03:50:07 | 0 | |||||
|
WI-Mc4rm1Hubr Resource Report Resource Website |
RRID:RGD_13825199 | Rattus norvegicus | The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. | 13825199 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13825199 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Fahem15Dlli-/- Resource Report Resource Website |
RRID:RGD_14398825 | Rattus norvegicus | This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates. | 14398825 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14398825 | 2026-02-14 03:50:08 | 0 | |||||
|
SD-Cryba1Nuc1Dbsa Resource Report Resource Website |
RRID:RGD_126925756 | Rattus norvegicus | This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. | 126925756 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925756 | 2026-02-14 03:50:09 | 0 | |||||
|
SHR-Gja8m1+/-Cub Resource Report Resource Website |
RRID:RGD_150520205 | Rattus norvegicus | This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH2-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress parameters in SHR rats. | 150520205 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520205 | 2026-02-14 03:50:09 | 0 | |||||
|
SD-Mir31em1Sage Resource Report Resource Website |
RRID:RGD_127285380 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos. | 127285380 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127285380 | 2026-02-14 03:50:09 | 0 | |||||
|
ACI-Pvt1em1Shul/Rrrc Resource Report Resource Website |
RRID:RGD_150520209 | Rattus norvegicus | The ACI-Pvt1em1Shul was created using CRISPR/Cas9 by Shull laboratory at UW madison. The exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion. This strain is now maintained at Rat Resource and Research Center. | 150520209 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520209 | 2026-02-14 03:50:09 | 0 | |||||
|
LE-Nrxn1em1Mcwi Resource Report Resource Website |
RRID:RGD_25330089 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Nrxn1 into Crl:LE embryos. The result is a 4-bp deletion in exon 1. Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 25330089 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25330089 | 2026-02-14 03:50:09 | 0 | |||||
|
Wpk Resource Report Resource Website |
RRID:RGD_14995941 | Rattus norvegicus | The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. | 14995941 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14995941 | 2026-02-14 03:50:10 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
