Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
AlkB-D135T Resource Report Resource Website |
RRID:Addgene_160433 | E. coli AlkB | Other | Kanamycin | PMID:33337498 | Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed Aspartic acid 135 to Threonine; deleted the first 11 amino acids | 2024-08-01 01:03:37 | 0 | |
|
pUPD P35S (GB0552) Resource Report Resource Website |
RRID:Addgene_160554 | 35s | Other | Ampicillin | PMID:28053117 | Compatible with GoldenBraid; insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
AlkB-D135G Resource Report Resource Website |
RRID:Addgene_160434 | E. coli AlkB | Other | Kanamycin | PMID:33337498 | Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed Aspartic acid 135 to Glycine; deleted the first 11 amino acids | 2024-08-01 01:03:38 | 0 | |
|
pEGFP-2xFYVE Resource Report Resource Website 1+ mentions |
RRID:Addgene_140047 | tandem HRS FYVE domain | Mus musculus | Kanamycin | PMID:10970851 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | two FYVE domains (amino acids 147-223), linked by QGQGS linker | 2024-08-01 01:02:32 | 4 | |
|
pAAV-nEF-Con/Fon-ChRmine-oScarlet Resource Report Resource Website |
RRID:Addgene_137159 | Con/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2024-08-01 01:02:23 | 0 |
|
pET-Sac-Abeta(MC1-42) Resource Report Resource Website |
RRID:Addgene_127151 | Abeta(MC1-42) | Homo sapiens | Ampicillin | PMID:33793198 | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:01:52 | 0 | ||
|
pDONR221_SLC17A1 Resource Report Resource Website |
RRID:Addgene_131888 | SLC17A1 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:07 | 0 | |
|
pDONR221_SLC7A14 Resource Report Resource Website |
RRID:Addgene_132173 | SLC7A14 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:08 | 0 | |
|
pDONR221_SLC25A22 Resource Report Resource Website |
RRID:Addgene_132051 | SLC25A22 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:07 | 0 | |
|
pAAV-nEF-Coff/Fon-ChRmine-oScarlet Resource Report Resource Website |
RRID:Addgene_137160 | Coff/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2024-08-01 01:02:23 | 0 |
|
pKD077 Resource Report Resource Website |
RRID:Addgene_136473 | SSB-mTur2 | Other | Ampicillin | PMID:32374866 | Backbone Size:5382; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | mTurquoise2 inserted between Phe148 and Ser149 | 2024-08-01 01:02:21 | 0 | |
|
pLX-TRE-dCas9-KRAB-MeCP2-BSD Resource Report Resource Website |
RRID:Addgene_140690 | Cas9m4-KRAB-MeCP2 | Synthetic | Ampicillin | PMID: | This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection. | Backbone Marker:Andrea Califano; Vector Backbone:PB-TRE-dCas9-KRAB-MeCP2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:34 | 0 | |
|
pCDNA4.TO-ORF73-2xCSTREP Resource Report Resource Website |
RRID:Addgene_136232 | ORF73 | Other | Ampicillin | PMID:25544563 | Backbone Marker:Invitrogen; Vector Backbone:pCDNA4.TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:20 | 0 | ||
|
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1 Resource Report Resource Website |
RRID:Addgene_159905 | Slc32a1 | Mus musculus | Ampicillin | PMID: | Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:03:36 | 0 | ||
|
pUPD2 SV40-AcrIIA4 (GB3333) Resource Report Resource Website |
RRID:Addgene_160605 | AcrIIA4 | Synthetic | Chloramphenicol | PMID:34632687 | Compatible with GoldenBraid; insert can be released with BsaI | Backbone Marker:self-made; derived from the BioBrick assembly plasmid pSB1C3 ; Vector Backbone:pUPD2; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pVD1 Multiplexing Edit En-1 (GB2242) Resource Report Resource Website |
RRID:Addgene_160564 | Multiplexing Edit (En-1) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pDONR221-SLC25A39_STOP Resource Report Resource Website |
RRID:Addgene_161136 | SLC25A39 | Homo sapiens | Kanamycin | PMID:32265506 | This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131970 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:03:40 | 0 | |
|
pVD1 tRNA-gRNA E4-En-1 (GB2243) Resource Report Resource Website |
RRID:Addgene_160565 | tRNA-gRNA position E4-En-1 (Multiplexing Edit) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244) Resource Report Resource Website |
RRID:Addgene_160566 | Multiplexing Edit (E3-E4-En-1) | Synthetic | Ampicillin | PMID:34276739 | Compatible with GoldenBraid; insert can be released with BsmBI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
pGT2 Resource Report Resource Website |
RRID:Addgene_13056 | Ampicillin | PMID:17113027 | pGT2 is an XcmI generated T-vector bearing GFP marker optimized for direct cloning. Colonies with insert are selected by GFP inactivation. | Backbone Size:3267; Vector Backbone:pGT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:02:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.