Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
JS200 strain Resource Report Resource Website |
RRID:Addgene_11794 | JS200 | None | PMID:12909725 | For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI. | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:01:20 | 0 | ||
|
AV04 Resource Report Resource Website |
RRID:Addgene_115926 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:01:20 | 0 | ||
|
BW-Para Resource Report Resource Website |
RRID:Addgene_172602 | None | PMID:34369028 | The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/. The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)]. The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site. The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:04:26 | 0 | |||
|
CLM24 ∆lpxM Resource Report Resource Website |
RRID:Addgene_132780 | None | PMID:33536221 | Genotype: W3110 ∆waaL ∆lpxM | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:02:15 | 0 | |||
|
MG1655-OptoCre-bla-P-R Resource Report Resource Website |
RRID:Addgene_188474 | P-R-lox-TT-lox-bla | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:05:08 | 0 | ||
|
MG1655-OptoCre-knt-P-R Resource Report Resource Website |
RRID:Addgene_188475 | P-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:05:08 | 0 | ||
|
MG1655-OptoCre-knt-P*-R Resource Report Resource Website |
RRID:Addgene_188476 | P*-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:05:08 | 0 | ||
|
B-95.ΔAΔfabR Resource Report Resource Website |
RRID:Addgene_197934 | RNA polymerase gene (T7 phage)/chromosome | None | PMID:25982672 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR. | Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None | 2023-04-01 01:05:28 | 0 | ||
|
FR-E01 Resource Report Resource Website |
RRID:Addgene_118727 | none | None | PMID:30403660 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at HK022 attB: pOSIP-KH-RBS2-dCas9 | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:01:21 | 0 | ||
|
IF189 Resource Report Resource Website |
RRID:Addgene_134836 | lysogen of a temperature-inducible bacteriophage lambda | None | PMID:28522818 | Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:02:21 | 0 | ||
|
E. coli ER1821ΔlacI Resource Report Resource Website |
RRID:Addgene_141407 | None | PMID:31980824 | λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:02:44 | 0 | |||
|
39R861+ Resource Report Resource Website |
RRID:Addgene_119737 | None | PMID:30738800 | Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files. | Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:01:24 | 0 | |||
|
CY027 Resource Report Resource Website |
RRID:Addgene_72402 | None | PMID:26315440 | No antibiotic resistance. | Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None | 2023-04-01 01:07:59 | 0 | |||
|
SJ358 Resource Report Resource Website |
RRID:Addgene_67755 | none | None | PMID:26251500 | The genotype of the strain relative to MG1655 is complex, since there are many single nucleotide variations and several 10-20kb differences (Brown & Jun (2015) Genome Announcements, Lyons et. al. (2011) PLoS ONE). There are a particular abundance of differences in the rDNA operons, which in several cases align more closely to E. coli strains DH10B, MDS42, and W. Particularly relevant genotypes are: λ+ gal+ eut+ pyrE+ ilvG+ rpoS33Am glnV(SupAm) evgA::IS1 Δrfb | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:07:44 | 0 | ||
|
MG1655 Z1 malE Resource Report Resource Website |
RRID:Addgene_65915 | MG1655 Z1 malE | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2023-04-01 01:07:38 | 0 | ||
|
LC-E03 Resource Report Resource Website |
RRID:Addgene_78552 | pTet--Cas9 cassette integrated at 186 primary attB site | None | PMID:27060147 | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | This is a bacterial strain | 2023-04-01 01:08:22 | 0 | ||
|
HL5410 Resource Report Resource Website |
RRID:Addgene_62820 | see comments | None | PMID:26261213 | MG1655 + lacIq intergrated at intS + ΔglmZ + Dhfq | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-04-01 01:07:28 | 0 | ||
|
HL 5226 Resource Report Resource Website |
RRID:Addgene_63667 | see comments | None | PMID:26261213 | MG1655 + lacIq intergrated at intS + ΔglmZ | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-04-01 01:07:31 | 0 | ||
|
BL21∆serB Resource Report Resource Website |
RRID:Addgene_34929 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2023-04-05 07:50:38 | 0 | |||
|
BLIM cells Resource Report Resource Website |
RRID:Addgene_35609 | none | None | PMID:10610690 | To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11 | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2023-04-05 07:51:07 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
