Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 611 results
Snippet view Table view Download 611 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_17676

http://www.addgene.org/17676

Species: Gallus gallus
Genetic Insert: c-src Y416F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17676 Copy   


  • RRID:Addgene_17678

http://www.addgene.org/17678

Species: Gallus gallus
Genetic Insert: c-src K295R
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17678 Copy   


  • RRID:Addgene_17679

http://www.addgene.org/17679

Species: Gallus gallus
Genetic Insert: c-src K295R Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article.

Proper citation: RRID:Addgene_17679 Copy   


  • RRID:Addgene_17680

http://www.addgene.org/17680

Species: Gallus gallus
Genetic Insert: c-src S12A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.

Proper citation: RRID:Addgene_17680 Copy   


  • RRID:Addgene_17682

http://www.addgene.org/17682

Species: Gallus gallus
Genetic Insert: c-src S12A S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17682 Copy   


  • RRID:Addgene_17683

http://www.addgene.org/17683

Species: Gallus gallus
Genetic Insert: c-src S12A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17683 Copy   


  • RRID:Addgene_17684

http://www.addgene.org/17684

Species: Gallus gallus
Genetic Insert: c-src S17A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17684 Copy   


  • RRID:Addgene_180248

http://www.addgene.org/180248

Species: Gallus gallus
Genetic Insert: NgCAM
Vector Backbone Description: Vector Backbone:pBa-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note: Plasmid contains a K609E mutation in NgCAM compared to the depositor's provided sequence. This mutation is not known to affect plasmid function.

Proper citation: RRID:Addgene_180248 Copy   


  • RRID:Addgene_165415

http://www.addgene.org/165415

Species: Gallus gallus
Genetic Insert: GgPCFT_NB
Vector Backbone Description: Backbone Size:6994; Vector Backbone:pBXNPHM3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_165415 Copy   


  • RRID:Addgene_51221

http://www.addgene.org/51221

Species: Gallus gallus
Genetic Insert: DCTN1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pGW1-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_51221 Copy   


  • RRID:Addgene_51412

http://www.addgene.org/51412

Species: Gallus gallus
Genetic Insert: DCTN1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pGW1-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_51412 Copy   


  • RRID:Addgene_49529

http://www.addgene.org/49529

Species: Gallus gallus
Genetic Insert: BMPR-1B DN
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.

Proper citation: RRID:Addgene_49529 Copy   


  • RRID:Addgene_49528

http://www.addgene.org/49528

Species: Gallus gallus
Genetic Insert: BMPR-1B CA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.

Proper citation: RRID:Addgene_49528 Copy   


http://www.addgene.org/54936

Species: Gallus gallus
Genetic Insert: Paxillin-KM
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592

Proper citation: RRID:Addgene_54936 Copy   


  • RRID:Addgene_54898

http://www.addgene.org/54898

Species: Gallus gallus
Genetic Insert: FAK
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592

Proper citation: RRID:Addgene_54898 Copy   


  • RRID:Addgene_54868

http://www.addgene.org/54868

Species: Gallus gallus
Genetic Insert: C-Src
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592

Proper citation: RRID:Addgene_54868 Copy   


  • RRID:Addgene_55003

http://www.addgene.org/55003

Species: Gallus gallus
Genetic Insert: C-Src DN
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Kinase Dead K295R. Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55003 Copy   


  • RRID:Addgene_55002

http://www.addgene.org/55002

Species: Gallus gallus
Genetic Insert: C-Src
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55002 Copy   


  • RRID:Addgene_55009

http://www.addgene.org/55009

Species: Gallus gallus
Genetic Insert: CCPB1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55009 Copy   


  • RRID:Addgene_55010

http://www.addgene.org/55010

Species: Gallus gallus
Genetic Insert: CCPB1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55010 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X