Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4650; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of tag at SwaI restriction site
Proper citation: RRID:Addgene_186397 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).
Proper citation: RRID:Addgene_186396 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5412; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal Snap-tag tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186395 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:5385; Vector Backbone:pDEST-pSP172BSSPE-Swa1::venus-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of N terminal Venus tag at SwaI restriction site
Proper citation: RRID:Addgene_186400 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5589; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mCherry tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186378 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4888; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence.
Proper citation: RRID:Addgene_186375 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4915; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal HA tag at EcoR V restriction site
Proper citation: RRID:Addgene_186374 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4926; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal HA tag at Stu I restriction site
Proper citation: RRID:Addgene_186373 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6000; Vector Backbone:pMal-C2; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: The MBP ORF can be sequenced using 5'-GAG CGG ATA ACA ATT TCA CAC AGG-3' as a tac promoter sequencing primer (in the forward direction). To sequence inserts fused to the C-terminus of MBP, the primers are 5'-GAT GAA GCC CTG AAA GAC GCG CAG-3' (forward) and 5'-GCA AGG CGA TTA AGT TGG GTA ACG C-3' (reverse).
Proper citation: RRID:Addgene_11086 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pUC57-R1R4; Vector Types:Other, Other; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_105110 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pXN21-Dest; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_105086 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pDEST-Tol2-pA2; Vector Types:Other, Zebrafish plasmids; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_109732 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pBXNPH3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_110098 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pBXNPHM3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_110099 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pFRT-EGFP-DEST; Vector Types:Mammalian Expression, Other, Gateway entry vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_106348 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_128321 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Dirk Landgraf; Backbone Size:5056; Vector Backbone:pDML112; Vector Types:Yeast Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: This is the empty basic yTRAP sensor plasmid. To sense aggregation of your favorite protein, clone the coding sequence into a pENTR clone, then perform LR reaction with pGAN147. The resulting expression clone should be linearized with NotI-HF enzyme prior to integration into the yeast genome. The sensor integrates into the HO locus, and can be selected for using nourseothricin.
Proper citation: RRID:Addgene_129202 Copy
Species:
Genetic Insert: HIS3 reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST6; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation.
Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a HIS3 reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols.
Proper citation: RRID:Addgene_13349 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:9709; Vector Backbone:pAW; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_133893 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5813; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Bacterial Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_131628 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
