Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
gCH29 (crCD81-1) Resource Report Resource Website |
RRID:Addgene_217344 | crCD81-1 | Homo sapiens | Ampicillin | PMID:38760567 | Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. | Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:54 | 0 | |
|
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1) Resource Report Resource Website |
RRID:Addgene_217341 | crCD55-4 gRNA: actggtattgcggagccacgagg | Homo sapiens | Ampicillin | PMID:38760567 | Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. | Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:54 | 0 | |
|
Human Genome-wide Intron Tagging Library, Frame 1 Resource Report Resource Website |
RRID:Addgene_216134 | Ampicillin | PMID:38641660 | Vector Backbone:CROPseq-Guide-BSD (#216123); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:50 | 0 | ||||
|
gWiz_BM40-vGAT-VH-hIgG1-CH1-TS-HIS Resource Report Resource Website |
RRID:Addgene_218436 | vGAT-Vh-hIgG1-CH1 | Synthetic | Kanamycin | PMID:38572021 | Sequence derived from NeruoMab Clone #: L118/80 - NeuroMab Seq is supported by grant NIH U24 NS109113. | Vector Backbone:gWiz; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Kanamycin | 2024-08-01 01:07:00 | 0 | |
|
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1) Resource Report Resource Website |
RRID:Addgene_217345 | crCD55-4 gRNA: actggtattgcggagccacgagg | Homo sapiens | Ampicillin | PMID:38760567 | Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. | Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:54 | 0 | |
|
pAAV.CAG.(mito).cpSFGFP.HaloTag Resource Report Resource Website |
RRID:Addgene_214925 | (mito).cpSFGFP.HaloTag | Ampicillin | PMID:38748581 | Please see bioRxiv preprint at https://doi.org/10.1101/2023.08.24.554624 | Vector Backbone:pAAV.CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:43 | 0 | ||
|
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE) Resource Report Resource Website |
RRID:Addgene_214881 | hU6-crB2M-EFS-PuroR-WPRE | Synthetic | Ampicillin | PMID:38387457 | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:43 | 0 | ||
|
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE) Resource Report Resource Website |
RRID:Addgene_214884 | hU6-crGLY-EFS-PuroR-WPRE | Synthetic | Ampicillin | PMID:38387457 | RfxCas13d guide array targeting HK1, HK2, AKT1, AKT2 | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2024-08-01 01:06:43 | 0 | |
|
AA369 Resource Report Resource Website |
RRID:Addgene_215987 | Start; u(S)ORF_v1.1; Stop; Start | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA124 Resource Report Resource Website |
RRID:Addgene_215981 | Start; p300_v1.2; Linker_v3.1; SV40NLS_v1.6 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA177 Resource Report Resource Website |
RRID:Addgene_215983 | Start | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
pUN1198 - pL0_pD4H (pro + 5U) Resource Report Resource Website |
RRID:Addgene_203894 | D4H promoter and 5'UTR | Other | Spectinomycin | PMID:38743349 | Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2024-08-01 01:06:01 | 0 | ||
|
pUN1215 - pL0_pDAT (pro + 5U) Resource Report Resource Website |
RRID:Addgene_203895 | DAT promoter and 5'UTR | Other | Spectinomycin | PMID:38743349 | Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | Mutation of BpiI or BsaI cut site for MoClo domestication: C>G -860 bp from start codon | 2024-08-01 01:06:01 | 0 | |
|
AA082 Resource Report Resource Website |
RRID:Addgene_215997 | Start; mTagBFP2_v1.1 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA277 Resource Report Resource Website |
RRID:Addgene_215999 | Start; NeoR_v1.1 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA104 Resource Report Resource Website |
RRID:Addgene_215998 | Start; Thy1.1_v1.1; Stop | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA414 Resource Report Resource Website |
RRID:Addgene_215991 | Start; V5_v1.1; HaloTag_v1.1 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA067 Resource Report Resource Website |
RRID:Addgene_215993 | Start; HygroR_v2.1 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA069 Resource Report Resource Website |
RRID:Addgene_215995 | Start; BlastR_v1.1 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:48 | 0 | |
|
AA016 Resource Report Resource Website |
RRID:Addgene_215927 | U6_v1; DR_v0 [EnAs]; BsmBI_v2; BsmBI_v3 | Other | Kanamycin | PMID:38484704 | Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. | Vector Backbone:pUC57-Kan; Vector Types:CRISPR, Other, Fragment; Bacterial Resistance:Kanamycin | 2024-08-01 01:06:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.