Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

22,429 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
gCH29 (crCD81-1)
 
Resource Report
Resource Website
RRID:Addgene_217344 crCD81-1 Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:54 0
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website
RRID:Addgene_217341 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:54 0
Human Genome-wide Intron Tagging Library, Frame 1
 
Resource Report
Resource Website
RRID:Addgene_216134 Ampicillin PMID:38641660 Vector Backbone:CROPseq-Guide-BSD (#216123); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:50 0
gWiz_BM40-vGAT-VH-hIgG1-CH1-TS-HIS
 
Resource Report
Resource Website
RRID:Addgene_218436 vGAT-Vh-hIgG1-CH1 Synthetic Kanamycin PMID:38572021 Sequence derived from NeruoMab Clone #: L118/80 - NeuroMab Seq is supported by grant NIH U24 NS109113. Vector Backbone:gWiz; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Kanamycin 2024-08-01 01:07:00 0
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website
RRID:Addgene_217345 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:54 0
pAAV.CAG.(mito).cpSFGFP.HaloTag
 
Resource Report
Resource Website
RRID:Addgene_214925 (mito).cpSFGFP.HaloTag Ampicillin PMID:38748581 Please see bioRxiv preprint at https://doi.org/10.1101/2023.08.24.554624 Vector Backbone:pAAV.CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2024-08-01 01:06:43 0
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE)
 
Resource Report
Resource Website
RRID:Addgene_214881 hU6-crB2M-EFS-PuroR-WPRE Synthetic Ampicillin PMID:38387457 Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:43 0
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
 
Resource Report
Resource Website
RRID:Addgene_214884 hU6-crGLY-EFS-PuroR-WPRE Synthetic Ampicillin PMID:38387457 RfxCas13d guide array targeting HK1, HK2, AKT1, AKT2 Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2024-08-01 01:06:43 0
AA369
 
Resource Report
Resource Website
RRID:Addgene_215987 Start; u(S)ORF_v1.1; Stop; Start Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA124
 
Resource Report
Resource Website
RRID:Addgene_215981 Start; p300_v1.2; Linker_v3.1; SV40NLS_v1.6 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA177
 
Resource Report
Resource Website
RRID:Addgene_215983 Start Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
pUN1198 - pL0_pD4H (pro + 5U)
 
Resource Report
Resource Website
RRID:Addgene_203894 D4H promoter and 5'UTR Other Spectinomycin PMID:38743349 Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2024-08-01 01:06:01 0
pUN1215 - pL0_pDAT (pro + 5U)
 
Resource Report
Resource Website
RRID:Addgene_203895 DAT promoter and 5'UTR Other Spectinomycin PMID:38743349 Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin Mutation of BpiI or BsaI cut site for MoClo domestication: C>G -860 bp from start codon 2024-08-01 01:06:01 0
AA082
 
Resource Report
Resource Website
RRID:Addgene_215997 Start; mTagBFP2_v1.1 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA277
 
Resource Report
Resource Website
RRID:Addgene_215999 Start; NeoR_v1.1 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA104
 
Resource Report
Resource Website
RRID:Addgene_215998 Start; Thy1.1_v1.1; Stop Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA414
 
Resource Report
Resource Website
RRID:Addgene_215991 Start; V5_v1.1; HaloTag_v1.1 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA067
 
Resource Report
Resource Website
RRID:Addgene_215993 Start; HygroR_v2.1 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA069
 
Resource Report
Resource Website
RRID:Addgene_215995 Start; BlastR_v1.1 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:48 0
AA016
 
Resource Report
Resource Website
RRID:Addgene_215927 U6_v1; DR_v0 [EnAs]; BsmBI_v2; BsmBI_v3 Other Kanamycin PMID:38484704 Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint. Vector Backbone:pUC57-Kan; Vector Types:CRISPR, Other, Fragment; Bacterial Resistance:Kanamycin 2024-08-01 01:06:47 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.