Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p5E-kdrl Resource Report Resource Website |
RRID:Addgene_78687 | kdrl promoter | Danio rerio | Kanamycin | PMID:17306248 | Backbone Marker:Invitrogen; Backbone Size:2600; Vector Backbone:pDONRp4p1r; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2022-11-11 12:19:21 | 0 | ||
|
pDONR221-ets2 Resource Report Resource Website |
RRID:Addgene_192724 | ets2 | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_001018874.1; homolog of human ETS2 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | N189D (rs502796915); S231N | 2022-11-16 12:18:10 | 0 |
|
pDONR221-get1 Resource Report Resource Website |
RRID:Addgene_192722 | get1 | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_001003413.1; homolog of human GET1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 2022-11-16 12:19:10 | 0 | |
|
pDONR221-kcnj6 Resource Report Resource Website |
RRID:Addgene_192725 | kcnj6 | Danio rerio | Kanamycin | PMID: | cDNA encodes homolog of human KCNJ6 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 | 2022-11-16 12:03:50 | 0 |
|
pDONR221-si:ch73-281n10.2 Resource Report Resource Website |
RRID:Addgene_192716 | si:ch73-281n10.2 | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_001296573.1; homolog of human HMGN1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 2022-11-16 12:18:10 | 0 | |
|
pENTR5'_ubi Resource Report Resource Website 1+ mentions |
RRID:Addgene_27320 | zebrafish ubiquitin promoter | Danio rerio | Kanamycin | PMID:21138979 | Backbone Marker:Invitrogen; Backbone Size:2692; Vector Backbone:pENTR5' TOPO; Vector Types:Other, Multisite Gateway 5' entry vector; Bacterial Resistance:Kanamycin | 2022-12-18 12:04:50 | 3 | ||
|
p3E_he1a:mCherry Resource Report Resource Website |
RRID:Addgene_113881 | he1a | Danio rerio | Kanamycin | PMID: | Cloned from the construct provided by Jeff Mumm's Lab, pTol2 5xUAS:mRFP-NTRmut;HE-mCherry Reference for the he1a promoter was first described in: Xie et al., "Silencer-delimited transgenesis: NRSE/RE1 sequences promote neural-specific transgene expression in a NRSF/REST-dependent manner." BMC Biology 2012 10:93 https://doi.org/10.1186/1741-7007-10-93 | Backbone Marker:Invitrogen; Backbone Size:2640; Vector Backbone:pDONR P2R-P3; Vector Types:Other, Zebrafish Danio expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:18:26 | 0 | |
|
pCRII-TOPO-ZFERV Resource Report Resource Website |
RRID:Addgene_11192 | ZFERV | Danio rerio | Ampicillin | PMID:14694121 | ZFERV PCR insert (the single 3' A overhangs on both ends are not included): 5'-TCTAAAGGAAAATGAACTTAACAGTTGCGAG (31 nt total upstream of the ZFERV sequence), CGAGgacaac agtggaatgg aatctttgtt aaatttagca aagtacagta aactgaacag agtattgcga ata -3' (73 nt total downstream of the ZFERV sequence). A map of pCRII-TOPO is available at Addgene's vector DB. | Backbone Marker:Invitrogen; Backbone Size:3950; Vector Backbone:pCRII-TOPO; Vector Types:Other, Zebrafish; Bacterial Resistance:Ampicillin | 2022-04-22 03:17:58 | 0 | |
|
MiniCoopR U6:gRNA spred1, mitfa:Cas9 Resource Report Resource Website |
RRID:Addgene_118843 | spred1 gRNA | Danio rerio | Ampicillin | PMID:30385465 | Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:01 | 0 | ||
|
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9 Resource Report Resource Website |
RRID:Addgene_118842 | cdkn2a gRNA | Danio rerio | Ampicillin | PMID:30385465 | Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:01 | 0 | ||
|
MiniCoopR 2xU6:gRNA pten, mitfa:Cas9 Resource Report Resource Website |
RRID:Addgene_118845 | ptena and ptenb | Danio rerio | Ampicillin | PMID:30385465 | Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:01 | 0 | ||
|
rag1 long Resource Report Resource Website |
RRID:Addgene_11299 | rag1 | Danio rerio | Ampicillin | PMID:9089097 | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(-); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:11 | 0 | ||
|
rag1 short Resource Report Resource Website |
RRID:Addgene_11300 | rag1 | Danio rerio | Ampicillin | PMID:9089097 | This is a rag1 PCR product. To make probes: antisense HindIII - T7, sense XbaI - T3. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(-); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:11 | 0 | |
|
p5E-1.7kbfabp6 Resource Report Resource Website |
RRID:Addgene_159087 | 1.7kb fabp6 promoter | Danio rerio | Kanamycin | PMID:34301599 | Backbone Marker:tol2kit; Vector Backbone:p5E-Fse-Asc entry vector; Vector Types:Other, promoter fragment 5' entry vector for tol2 cloning; Bacterial Resistance:Kanamycin | 2022-10-07 04:37:43 | 0 | ||
|
pDONR221-appa Resource Report Resource Website |
RRID:Addgene_192745 | appa | Danio rerio | Kanamycin | PMID: | cDNA encodes AFN73054.1; homolog of human APP | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | S47N | 2022-11-23 12:03:00 | 0 |
|
pTwist-ENTR-rbm11-202 Resource Report Resource Website |
RRID:Addgene_192729 | rbm11 | Danio rerio | Kanamycin | PMID: | cDNA encodes rbm11-202; homolog of human RBM11 | Backbone Marker:Twist Bioscience; Vector Backbone:pTwist ENTR Kozak; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 2022-11-23 12:16:19 | 0 | |
|
pDONR221-nrip1a Resource Report Resource Website |
RRID:Addgene_192731 | nrip1a | Danio rerio | Kanamycin | PMID: | cDNA encodes XP_005157806.1; homolog of human NRIP1 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | E662Q; S895P; H967Q | 2022-11-23 12:03:00 | 0 |
|
pDONR221-btg3 Resource Report Resource Website |
RRID:Addgene_192735 | btg3 | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_001313635.1; homolog of human BTG3 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | H211Y | 2022-11-23 12:03:00 | 0 |
|
pDONR221-cxadr Resource Report Resource Website |
RRID:Addgene_192734 | cxadr | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_694480.1; homolog of human CXADR | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 2022-11-23 12:03:00 | 0 | |
|
pDONR221-ncam2 Resource Report Resource Website |
RRID:Addgene_192739 | ncam2 | Danio rerio | Kanamycin | PMID: | cDNA encodes NP_571905.1; homolog of human NCAM2 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin | 2022-11-23 12:03:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
