Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/186396
Proper Citation: RRID:Addgene_186396
Bacterial Resistance: Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Vector Backbone Description: Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pDEST-pSP172BSSPE-Swa1::RfA.
No alerts have been found for pDEST-pSP172BSSPE-Swa1::RfA.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant 2U24DK097771-09.
Email: info_at_ dknet.org
