Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
pDEST-pSP172BSSPE-Swa1::RfA
RRID:Addgene_186396 RRID Copied  
PDF Report How to cite
RRID:Addgene_186396
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/186396

Proper Citation: RRID:Addgene_186396

Bacterial Resistance: Chloramphenicol and Ampicillin

Defining Citation: PMID:17878951

Vector Backbone Description: Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin

Comments: Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pDEST-pSP172BSSPE-Swa1::RfA.

No alerts have been found for pDEST-pSP172BSSPE-Swa1::RfA.

Data and Source Information

Source: Addgene